Description :
From Genome Similarity Track
Location :
Scaffold_2:4279944- 4284008
Transcript NameFunction/comments
Physo_409739AlNc14C1323G12888
Physo_486985AlNc14C633G12302
Physo_410245Os10g0130700 putative
Physo_326912PREDICTED: copia proteinlike putative

Sequence
4064 bases(100 bases per row)
ATTATGCACAATCAGACGATATCGTCTAATGATCTGGTTTGCGTAATCAAAAGCTGAGGCCACGCAGTGCAAGCGTTCAACTTTCGATAGCTTGCGCAGT
AGGGCGATCCAAAGCACAGGACCTCCTTCATTTCGAATATCACGAAATGTACTGTAAGATGGATGAAGCCTTGCGTTCATTAACTACATATTTGAAAATT
TTAAAATCGACAATGTCCCGAAAACGGGCTAGATGCGGTAAGGTTTTCCCAGTCAACCATTGTTAAAGCTGCTTGTTTTGAGTACCTGCCCAAAACGACA
ACAGCAAAGAAAGGTAGCAAGACCGTGTGAGTCAAGTGCGCTGGAAACGAGAAGGATCGTACGATGGTTATGCTGCTTGGGGACTCCCTGGGCTCGAAGT
ATAGTCATTTCATCGTATTCAAAGTCCGCGAATCCAAGATTGAAATCAGGCGCCAAGAAAACAAGACTTTTCGTCATGAGTTCAGCCGAGGTATGTGGAA
GGACGGCATCGCCCTCGCCCAGCAAAAGTACGCCATACAAGTATATGCAAATGACAAAGGTAAACAGACAAGCTTACTTTGTAATTAATTATGATACTTA
TTGTTTTGTGCTAAATACAGGTTAGTGAAATAGTGATTTACAAGTGCAATGACTGTATTTTTTCACTTTGGGAACCCTTCCGATCCTTCCGAACTTATAT
TGCTGATCGACGACTTTTCCTGTCACCGGACCGATGAAGCCGCGGCGTACGCAACTGAAATTGGTGTTGCGGCTCTCAAGATTCCGCCCAATTCAACCTC
GGTGTGCCAGCCACCGCAACCCCGGTGTACCCTTCAAGCTGCAAGTTCCAGACAGACTCAATTTGTGTAAGTGGGTGCATGAAGCCTGGAATGATATTGC
ACCCGCAACTATCATTTTAGGCTTCAAAACCTGTGGTCTAATTGATGCACCTGAGGACATTCAGGAGGCGGAACCAGTCCAGATTGGAGATGCCGAAACA
AGCGTCAATGTAGTTCTCGATACAAGCGAAGTAGACCAGGAGGTGGGCATCTTTGTTTAGATGACGATTTTGATGACGTTTTTCGTAATGTTGCTTCACT
AAGCTAATACATATCTACATGTTTTAAGCTACGTGTATTGTGCTTTGCAGACGTTTTGGCACTTCGGACTGTAACTCGTACGACTTATCGAGCACGACTT
ACTGATAAATCGTACTCGAGTACGAATTGCTGTAAGTCGTGCATGGCCAATCAGTAGTACGCATACGCCATCGCCTGCATGATTAAGCACATCCAGTACA
GATTAGCATCAGTTTGGCGCTTTTGGAAAGTGTCATTTCCGAGTCAAACCGGGGTCGAAACACGACTTGAGGAACTCGCATTCAAGGCCACTATGATTTA
CCGCTAAGTACGAACACTAAGTAGTGCACTAAATAGGAGGGCAAACTGGACGCAAAGCACAATACGTTTCCTCCCTACAATTCCATTTATCCGGGTCATG
TTCAATCCTCTCTATAACCTGGAATCAGCCTGTTTGCGATTACATAAGGAATGCGGTAAGCTTGCAGAACTGACACAACTGCCAAACGTTTATTCCTTGC
AGACTTCACCTAGAGTCATTCCTAAGGGGCTGGTCAGGCAAGTTATCGTGGATTTTAATTGGCTAAAATTAAAATCCGTTTAGGGGTTGTTTGGAACCGA
CATGATCAACTTTGTGGATCAGAGCTAATTATGTGAGGAGCTTCCTCGCTTAAAAACAAAGTTTAAGTGACGAAGAAGTTCGAACACTCCATATTCTTTT
TAAAGGAGGGCAACTGTCGCACACACGTGCTGCGCACCGACAGTGGGGGCGAGTACATGAACGTTTAGGACTTCTACCACGCTACTGGTGTGCGTCGGTA
AGTTATTGAAGCCTACAGCCAGGTCTTGAACGGCAAATCCGATCGAATGCACAGAACGATCTTCAACATGGCTGGCCGCATGTTGTTTGTAAGAGGGCTG
CCACTCAAGTTCTGGGGGTGAGCAGTCGAGTACGTTGCGTATGTGCTCAACCGCAGTGCGTGCAGTGCCAACTTCGGGCGGATGTCGCCCATTGGGGTAC
TGACTGGCAAGTGCCCGGACATAGCGGACATCCTGACTTTCGGCAATTCGTGAACTGCGTATCGAGATTCATGCAAGAAAGTCTGGTAGCCAAGGGCCGA
GGTGGAGATGATCGTGGAGAAGAACGACGAAACTAAAGGCTTCACGGTGCACCTCCCCAAGGACATGGTCGTAGTGACGATGCAGCGCGTCGAAGATGCG
GAGATGCTTGATAACCGACAGAACGTGTGGTTGCATGTGCAAATAAAGACGAAGGACCCGAAGTTATGGCACTCGATCGAGGAGCGCGAGGAGGCTGCAA
AGCAATAGGAAAAAGAAGAAGTTTGGATTGAGTGCGGCGTGAACGGTGCGAGAGACCATAGCGGATGAGCACAAGAATGATGCCGACGGAGAGCTCCTGC
CGAACAAAGGGACAGGAAGCCCCGAGAGACCGACGGTGCAGACGTTTCAGTCCTTGATCGGAGGCCTGTTGTGGATCGCCCGGTGCACTAGGTCAGACAT
TGCCTATACGATGTATCGGGTGACGAGGCGCGCACACGCGCCTAATGTGAGTGATTGGCGGACACCAAGTTCGCCATTCATGCAGCGTGAGCGAGGCCAC
AATTGTGGTGGAGGGGTAAAGTGATGCTGACTTCGCCGGCGACCGCGGGGATCGCAAGTCGGTGAGGTGGTGGCGTGCTGGCGGTCTTCAACATGGTGGT
TAGCTGGATCTGCAAGAAGCAGAGCAGCGTCGCCGTGTCGCAGGTGGCGGCCGAGCTGTGGGGCATCGGCCAGTTGCTGAGCGAGGTCGGACTCAAGATG
AAGATCCCCTACAAGTTGTCCGTAAGCGATCATCAAGTAAATAGAGGGCGAAAACACGTCTGGGTGCGCGAAGCACATAGCCACAAGATTCAAACTCATC
AAGGACCCGCCTAAGAACAAGAAGCTAAAGGTCGCTTACTGCAAGTCCGGGTTGATGCGCGCGGACATCTTGATGAAGGCCCTGTCGACGTTGAGACCCT
TGGCGTCAGGCGCTCATCATGCTCACGACACAACGGGCCCGTTTGAGCTGCCGGCGAATCGCTAGAGCTGACTATGGTCCGCCCAGTAATGATCCTTGTC
CCCTACAAAGTATGGAGTGGACTTTGACATGCGAGTAATGGGAGTCCATTGCTGAGGGCTTTCGCAGTCAATGCGGGTTATAATTATGTTGCGGAGCAAT
GGGTCGAACCCTAATTGCCTTGAAACGTCCGTCCGTATGATTTCGAGAGATAATACAATCGCAGAGGTAATTTGCACAATTATTTTACTTTATGTTTTGC
TGACATATATCTTTCATTATACTATATTTGGTATCCCTCTATGGATGTTTTAAGTTGCGCACGATCATCGCAAAATAATTATATCTGTTGGCATACGCCC
TGGTTCTTGGAGCGACTCCAAAGAGTCAATTTTTGGCCTCAATGTTAGTCGTCTACTTCCGCCAGTTTATCATGTTCTAGCCGATTCAGATTATCGTTGG
TTATGAACCCATACAACGAGCTCCATGAAGATGGTTCATTACTGAGAGGTCTCATGTTGAGTCTCTTCATCGCCAAGGTGGCGGTCACTACGTAGGGTAG
GTGCCATGCGAGGCTACAGCAGTAGGAAGTTGTAAAGGTAAGTCAACACGTAAGTGCCGGGCAAACGACCGCGACAGATACAGTGGTGGAGCTCTCAGTG
CTCTCTATTGCTTGCAAAGCAACAAAAGCAGAAGTGTGAGAGAGCACGAGTTCCCCGCAAGCCACCGTACCGCAGAGTCAATGCCATACTATAAGCAAGA
AAGTCTATACAAAGTCAAAGTGCTACAATCTCCGAAGCACGCAGCCAGCAATTGCCAGCGGCATACAGTCTTCAGGTAAGCGCCTCGCAGGCAGGCACGC
GGCCGAGCATGCAACCTGCAACCGTAGACGCGTGCTGCAGCAGGCGCAAGATCTCAAGTTCAGG