Description :
From Genome Similarity Track
Location :
contig_28:427962- 430196
Transcript NameFunction/comments
g6978.t1RAW37005.1 Transmembrane 9 superfamily member 7 [Phytophthora cactorum

Sequence
2234 bases(100 bases per row)
CTCTGCTCGCTCTAGTCGACCTTGATGGACGCGTAGATCTTGCGCGTGAACCACAGCGAGGCACCGACGCCCACGGCGCCCGTCAGCAGCGCCAGCGCGC
CCGAGATGACCGCCATGTAGCCGAAGTACAGCATCGCACCGATGAAGTTCGCCACGTCCAGACGCGTCCAGTAGTAGTACGTCGAGTAGAGGAACACGTA
GCCGCCACAGGCGCCCGACACGAAGAACGACCGCCACCACCTGCGCAAGACAAGTAAAACAAGTCGCCCGTTAGCTACTGCAGCGTAGATAGGTCGATCT
CCTGGCGCACACGTACCAGTTGTAGTCTTCAGCGCAGAGTTGGAAGTAGGTGAGCACGATGGTGATCTCCGCGCACGTGTTGATAAGGATAAGGAAGGCC
AGCAGCAGGAAGCCGAACACGTAGTAGTACTTGTCCGTCCACAGCGACGACAGCACGAAAAAGAGCTCCACGAAGATGGCTCCGAACGGCAGCACGCCGC
CCACGGCCGCTGCCGACATGTGGGTCATGTACCACGGCTGCGGGGGCACCGGGCGCGGGATGTTGCTCGTCGCCACGGGGAACGCAAGAGGCGCTTTCCT
GTAAACGACAAATACAAACGATGTTGTCACCAATCTCCCTCTACGAAAGCGGTTTGCGCATCAAACGCGCGCGTACCTGAAACCGAAGTAGGCGCCCGCA
AACACGAGAGGCACGGAAATGCACGTCCAGAGGAAAAAGACGAGCAGGATGGAGCCGAACGGCACAGCGGCGTCCGAGCCAGCACCCCAGACGAACAGGT
TCAGGAAGAAGAAAAGCGAGAACATGATGCCCGGGAACAGCACAGCCGTGAGCACCGTGCACATCTGCCAGCGCTTGCCCTTGAACATCTTGTACGTGCG
GGCCGACGTGAAACCCGCCAGCATACCCAGCAGCACGAAGCACACCAACAGGGCGATCACCAGCTTACCGCGGTTCGACGGGGCCAAGACACCAACGGCA
GCGAAGAACAGCGTAACGAGCGCCATGCCAAGCAGCTGGCAGCCCGTGCCCACCATGACGCAGAAGAGCATCGGGTTCTTCGACGGCGGGCGGAACACAT
CGGCGTGCACCAGCTTCCAGCCAGACTCTTCACGCTCCTCGGCACGCTCCTCCTCGGTAGGCACGCGGTTGTAGCGGCTGATATCGCGGTGAAGGCTGCG
CATGAGGATCATGCCCACCATTCCACTGAGGAACAGCACGATCACCAGCGCGTTGATGATGGAGAACCAGTGCACCTCGTCGCCGCCCGAGCCCGCGTCA
AAGTACACGTCCCACCGCGTGCGCCAGTCGTGCTCGTTGTCGAGCACCCACTCGACACTGTAGGTCCAGAAGACGGGCATCTTGCCGTCCTTGTTCTTGC
GCACGTACAGCGGGCGCTTGAGCTCGCTCGAGTGTTCGCACGCGTCCATGCGGTTGTTCTCCTCGTCGTAGCTCCTGGCCGCGTACTCGAAGCTGTACGG
GATGACCTTAAAGTCGACGATGCGTCCCTCGTCCTCGGAGCTCTCGGCCGTGCCCAACGGGTTGTTGTTGTAGCCCACGAGGATCTTGACGTGGTTGTTG
AGCTGCGGCACGACCTCCACCTCCGGGTTGAAGCTGCCCAGCGGGAAGCCCACCGTCATGCCGCCTTCCAACGACACGGACGTGGCCGGGAGGTTGTCCA
GGATCCAGTTGACGCGGTACGAGTCCTTGATCTTGTCCTCCCACTGCTTCACCTCCTTGTCCTCATACTCCTGTTTGCACAGCACGGAGCACTCGTGGCC
CTCGAGGAACTTGAGCTCGTACGGGGAGTTCTGGATGCGGTTGGCCGTCAGGTACTCGCCCAAGTTCTCCGACTTGTACTCGATTTTCTCCGGCTGTACA
GACAGTAAAACACCAACCCTCATTAGAGCAATGTTCCCTAGAATAAGAAACCCTAGTGCGCCCCACCTGACAAAACGGCAGCTTGTAGTAGTCCAAAGGC
AGCAGCGTCTCGCCCGACTTGAGGCTGTTGACGAAGATGGGCAGCGTCTCGCCCTTGGAGTACGTGGTCATCTGCACGCCCGGCAGCGAAAAGCCCTCGC
TGGGGGACGCCAGCGCGGCCACCGCCAGCGCCGCGAGCAGCGACTTGCTCGGTCCACGCATCCTTCCAAGTAGGCTCCAGCTTAGGGCTTGAAAGAGGAA
AACTGGCCGCCCCTTCCAGCACTATCGGGGCTTC