Description :
From Genome Similarity Track
Location :
Scaffold_134:42791- 46890
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_134-fgenesh-gene-0.4Protein kinase

Sequence
4099 bases(100 bases per row)
GCACGCGCTGcTGTtGTACAGGCATTTGCtCcGCGCCCACTGTGTGCTGGAGAAGgACCGCATGTtCAAaGACTTCAACCCGGTGCAGCGGAAGTTTCTC
ATTGAGCgaTGCCAGCTGGAAGCATTCAACGATGGAGAGCTCATCTGCCGGCAGGGAgAACTGGACGATCGGTACTTCATCCTGGCTGAAGGGGAGgCAC
AAGTGTTCGTTGAGGACGGCGGTGCTATGACGCTGGTGGCCACTAAGTCACTGTTCCAGAGCTTCGGAGAGATGGGGCTCCTGGATAAGCCTCGCACTGC
AACGGTTGTCGCCACCGGCGCCTCAGTGCTGTGCATTGTCATCTCAcGCAAGCAgTACATCGCAGCTGCACAACTGTCGGGCACTGGTTCGACGCTCGAT
GTAGACGCTGAGGCCTTGCTGGCGACCACTCTCATTGAAGAGTGGAATTTAGTGATCAACGCTCGGAACCTGCACCTCTCCAACCCCcAAGTGGCGCACT
ATCTCGTCACTTTCATCAAGAAaTTCAAAGCAGCGTACAACCAGAAGTTCGTAGGACGTACGCTTTACCTCGATCTCTTCCGCCGTCTTCACCGAGAGCC
GTCGCTCACGGAGGAGTTCGAGTTCCTCACATCTCGAATCGCGTGGGATTCCCCAGCGTCATCGCTTGGAATCATCCGGTCGGAGACgAGGCGTGTGCTG
TCCAaGCAACCAACGGATCGCTCCGCTGATGAGACCTCGTTCATCGGTCGTCTCATCGAACACACGGCGTTTCtATCGAAATTCGATGTCCCTGGCCCGC
ACGTAGATCGATACAAGCTTGCGAGATGCCTCGCCAAGGTCGTGGTGTTCGCCAACaTCTCCAAAGaCGCTTACcTCTTCCGACAAGGCAAGATCGAGAg
TCGGGCTTtCCTGATTCTGCGAGGCAAGAtcAACATCGTGAACGAAGATGTAAGTGTCGCGAACAACATGATCAAGCACCATGAGGTGCTAGCGACCCTC
TCCGCTGGCGACTCGTTCGGCGAGCTGAGTCTCGTGACGAGGCTGCAGCGCTCGGCCACCACTGTGGCTGGTTGTGATACGGACTTGCTCGTGTTCGACC
GAGAGCATCTGCTTCACGTTCAGTCTGCTCTTCCTGGTGTGTCCGTGCAGCAGGTGATGGTGCAGCGAGCCGAGTTCTTGTCGCGGTTGAGCTTCTTCAA
AGGCAGCGATTTCGGACAGTGCATCCGTGTGGCCCACGACCTGCAAGAGGCCGTGTACGACGCTCGCCATTTGTTCATGCAGGATGTAGCGCAGCAGCGA
ACGCTGTTCATTGTCAAGAGTGGGGAGGTCGCAGTCTTCATGAAGACACGGCTACCAGCCGACTGCACTTCGGTGGGCGCTTCCCAACCAAAGCCGGCAC
TCGTTCGCGTTGCGACCATCGGGGCTCAGGAGTTCTTCGGCGTTGCAATTGCGACGATCAACATGGGCCCCACATCATCAGCACCTCTCTCTTCCtCGTC
TGCGGCGCTGCCTTCGCTATCTGCATCAGTACCTCCAGCGTGTGATTTGGGTGCCGCCGTGTACATGTGCAcgTCACGAGTCGTCATATTGGAACTGTCG
GAGCGAGggTGGCGTCGCTTGTGTCCACAGAGTCTCGTCATCATCCGCAACGCCCTCATCGAGAGACACAAGTGGAACGAAAATGCCGCGCGGCAaGTCA
CAGCCAGcGGCCAGCACTACTACCACgTTGACCGTCCGTGGCAGCAaCTCAAGGGAAGTTCGAGTCCAGGACGCTGCAGTACCTCGACGATGAGTGGCGT
AGGTACCACCCAAGGTTGTATCACACCCAGGACTGCATCGCACTTGGCTCGCCATCTCGTCGAGAAGCAGACTCACAGGAGCACCTACGCTGCACTCTTC
TCTCCAGGGCCTGTTGGCGCCGACGGCACGACGGCGACGAAACCcAGTCGGGCGTCAGAGATTCGCGCAGCAGTTCCTCTCGGCCCAAACTCTGCGGCTT
CCACGAAGGCTCTGgggTGGgACATGGGCTTGAACTCTCCAAATGCTATGTGTCCACCACACTTTGAGCCTCCCGTTCCCAGCCTCACGCCGCTTATCAC
GTTTGGATCTTGGACGCCGCCGTTGACATCTCTACTACCTCCATCCTTATCTCCACGCACTGCACCCTTACTGCTTCTCACCACAAAGAAGGATCAACGC
ACGAACAACCAGGCGACGACACAGCACAAGGTCAACGCTGCGGAGGACTCTGCATCTCTATGGAAAGCCAGGTCGAATCCACGAAGACTAGTCGAATATC
AGGCACCATAGCTtcTGACCTCGCTATTTCTAGATGAAGGGGAGCGGCCAGATCCGCGTCTCGAGTCTCGACGACACCGCCGGTGCGTTGGGCCAAGTGA
GAATCAGGCCCAATGGAATGGTCTCCGCAGTCAACAGGAAGtCATACGTCAGCTGGGCTGCGTCACGCCACCCACTGGCTGTTCTCCCGCCTTGCTGGTG
CTGAgagCGTGAATGTGCCAGACACCGCAGTGTTTGATGGCCAAGGAATTCTCGAGACGTGGGTGTGCACGAGCGTTGGCAGTGCGTCAGgCAAGTCCAA
GCAACGGAGCTCGTCATATCGCGTTGCGAAACGTAACCCAACCGAGTTGAATCTGCTGCGCTTCGAAGCGCACCTACAAGACACGGGCGTTGATCCAAAT
GGCAACGTCGCAGTGGCGTATGACGGCGAATTtCCGAGGACACTGGACGAAGCtCAACTCGACAGCTTCATTCGAGTCTtGTGCGcGCGTGAACGAAGCC
TAACGAGTGCCGAGCCCGATTtGTCGCTTCCACTGTCGTATCCAGGCGGTGGATTTACgCTCCAAGCAGTCGCTGGAACCCCGAAGCTGGAGCAGGAGGC
GCGCATCCGCACGACTTtCATGGCAGTCGACGAAAaCCTCAATCGCCAAGTTGAGGgACATtACACACACGAGGTCAAGAGGATCCAAGCGTCTGACGCC
AGAACAAGTGAGGCAGCGCTGCAAGACGGATGGAAGTCCCTACTGGTGCACACTGAAAGTCAGACAGCAGCGATCGTGAAGCACCTCTTCATAAGGCATC
GAGTTCGTGTCCAGCGAATGGAGCTTTGCTTCGTCATGACCAAGGCGGTGGGAATACAACTGACGTGTGCCGAGTTtCTTGAATGGAGGGAAGTCGCACA
AACCGAGACGCATCGGATGGACAACAACAGGGCACAGAGACGAGCTATCAAACGGGACCCAAAGTGCGCATCGCGTCGCGGATGGAACTATCGCGTTTGC
CGAGAGTGCCGGCTGCCGCTTGAAATGGACCTCGCAAACGAGCTACTACGTAGCCAGGCGCTGGTGCGGTCGGTGGTCGCCAGCCAACAAGACTTGCTCA
TACGCCACCGCCAAGTGGAGAAAGAGAAGGAGCTCTTGAAAAGTGAGTTGGTGCGACAGCAaTCGGAGATGGAGAATCTCAACCTGGAGGTCTACAGACT
CCGCGAAGACTTGCAGCGCTTCCGCTCCGAGTACGATGCACTGCGTCAACAAAACGTGGAACTCGAGACACGTGTTCAGACTATGCTGGAGGAACGAGAC
CAAGCGCAGCAAGAAGTGACGGCAGCGCTTGACGCCATGACTGAACTTCagAATTCAGATGCAGCGGAACTGGAGAAGGCGAGAGTCACCATCGCGGACG
AGCAGAGCGAACGGAAGTCtcAAAGTGACACgATAGAGGCACGGTTTCgaCAGCTGCGAGCAGAAGTCCAAGGTCTGCAGCTCTCCAATCGCGAGTGGAA
GGGCAAGTTCGAAGAGGTCCGAGCTGAGCGCGACGAGCTACAGTTCCAGTGGGGCTTCGTCGCGCGGAAGCTGActGACGTGGGCGACatGGgCGTGTAT
CCACCCAAGCGAGTGGCAGGGGGCTTCAGCTCGTATtcTACGCCATCACATCCGAATGTAGAGCTtGTCGTGAAGTGGATCGTCGACTACGAGGCGAAGC
GCTCGATACTCGACaCACAGCAGCAAGCGAAGACTGGACAGCCcAAGGCGATCAGACGGCGCCTCAGATTCAAGTTGGAGCTCATGAGGGTACTAGCGA