Description :
From Genome Similarity Track
Location :
contig_28:427890- 430124
Transcript NameFunction/comments
g6661.t1hypothetical protein

Sequence
2234 bases(100 bases per row)
CTCTGCTCGCTCTAGTCGACCTTGATGGACGCGTAGATCTTGCGCGTGAACCACAGCGAGGCACCGACGCCCACGGCGCCCGTCAGCAGCGCCAGCGCGC
CCGAGATGACCGCCATGTAGCCGAAGTACAGCATCGCACCGATGAAGTTCGCCACGTCCAGACGCGTCCAGTAGTAGTACGTCGAGTAGAGGAACACGTA
GCCGCCACAGGCGCCCGACACGAAGAACGACCGCCACCACCTGCGCAAGACAAGTAAAACAAGTCGCCCGTTAGCTACTGCAGCGTAGATAGGTCGATCT
CCTGGCGCACACGTACCAGTTGTAGTCTTCAGCGCAGAGTTGGAAGTAGGTGAGCACGATGGTGATCTCCGCGCACGTGTTGATAAGGATAAGGAAGGCC
AGCAGCAGGAAGCCGAACACGTAGTAGTACTTGTCCGTCCACAGCGACGACAGCACGAAAAAGAGCTCCACGAAGATGGCCCCGAACGGCAGCACGCCGC
CCACGGCCGCTGCCGACATGTGGGTCATGTACCACGGCTGCGGGGGCACCGGGCGCGGGATGTTGCTCGTCGCCACGGGGAACGCAAGAGGCGCTTTCCT
GTAAACGACAAATACAAACGATGTTGTCACCAATCTCCCTCTACGAAAGCGGTTTGCGCATCAAACGCGCGCGTACCTGAAACCGAAGTAGGCGCCCGCA
AACACGAGAGGCACGGAAATGCACGTCCAGAGGAAAAAGACGAGCAGGATGGAGCCGAACGGCACAGCGGCGTCCGAGCCAGCACCCCAGACGAACAGGT
TCAGGAAGAAGAAAAGCGAGAACATGATGCCCGGGAACAGCACAGCCGTGAGCACCGTGCACATCTGCCAGCGCTTGCCCTTGAACATCTTGTACGTGCG
GGCCGACGTGAAACCCGCCAGCATACCCAGCAGCACGAAGCACACCAACAGGGCGATCACCAGCTTACCGCGGTTCGACGGGGCCAAGACACCAACGGCA
GCGAAGAACAGCGTAACGAGCGCCATGCCAAGCAGCTGGCAGCCCGTGCCCACCATGACGCAGAAGAGCATCGGGTTCTTCGACGGCGGGCGGAACACAT
CGGCGTGCACCAGCTTCCAGCCAGACTCTTCACGCTCCTCGGCACGCTCCTCCTCGGTAGGCACGCGGTTGTAGCGGCTGATATCGCGGTGAAGGCTGCG
CATGAGGATCATGCCCACCATTCCACTGAGGAACAGCACGATCACCAGCGCGTTGATGATGGAGAACCAGTGCACCTCGTCGCCGCCCGAGCCCGCGTCA
AAGTACACGTCCCACCGCGTGCGCCAGTCGTGCTCGTTGTCGAGCACCCACTCGACACTGTAGGTCCAGAAGACGGGCATCTTGCCGTCCTTGTTCTTGC
GCACGTACAGCGGGCGCTTGAGCTCGCTCGAGTGTTCGCACGCGTCCATGCGGTTGTTCTCCTCGTCGTAGCTCCTGGCCGCGTACTCGAAGCTGTACGG
GATGACCTTAAAGTCGACGATGCGTCCCTCGTCCTCGGAGCTCTCGGCCGTGCCCAACGGGTTGTTGTTGTAGCCCACGAGGATCTTGACGTGGTTGTTG
AGCTGCGGCACGACCTCCACCTCCGGGTTGAAGCTGCCCAGCGGGAAGCCCACCGTCATGCCGCCTTCCAACGACACGGACGTGGCCGGGAGGTTGTCCA
GGATCCAGTTGACGCGGTACGAGTCCTTGATCTTGTCCTCCCACTGCTTCACCTCCTTGTCCTCATACTCCTGTTTGCACAGCACGGAGCACTCGTGGCC
CTCGAGGAACTTGAGCTCGTACGGGGAGTTCTGGATGCGGTTGGCCGTCAGGTACTCGCCCAAGTTCTCCGACTTGTACTCGATTTTCTCCGGCTGTACA
GACAGTAAAACACCAACCCTCATTAGAGCAATATTCCCTAGAATAAGAAACCCTAGTGCGCCCCACCTGACAAAACGGCAGCTTGTAGTAGTCCAAAGGC
AGCAGCGTCTCGCCCGACTTGAGGCTGTTGACGAAGATGGGCAGCGTCTCGCCCTTGGAGTACGTGGTCATCTGCACGCCCGGCAGCGAAAAGCCCTCGC
TGGGGGACGCCAGCGCGGCCACCGCCAGCGCCGCGAGCAGCGACTTGCTCGGTCCACGCATCCTTCCAAGTAGGCTCCAGCTTAGGGCTTGAAAGAGGAA
AACTGGCCGCCCCTTCCAGCACTATCGGGGCTTC