Description :
From Genome Similarity Track
Location :
Scaffold_358:42778- 44192
Sequence
1414 bases(100 bases per row)
CGGATGTCGACACTGGACATTGTTGGAATCTCCCTCTGGGTCATTGGCTACGTGCTGGAGGTCACGGCCGACTACTACTCTGTTCCATCTCAAATCTAAC
GCAACGAGCGACCGCACAAAAATAAATGATATCATTGGCTATTATTAGGCTAAGAATAGAGATTTGCTATTTTTTAATTTGTGGCTACCAGCTACATAAT
ACGTATCAGCTGTGCAGATAAGCATGATGTGCTGCCGTCTGATCGCTCTAACGGCAGGCACAATAAATGTTGATGCTGTCAACATCGCTATCAAATACCA
GCCAGCTAAGTCGCCCGATATGAACGTACTCGAATTGGGTCTGTTTAACTTGCTACAGTCGGCTCAATACCGCACACCAACGTACAAGATCGATGCTTTA
ATTGCGGAAGCTGAAAAAACTTACTGTGATCTTTCTAGTAGGACTATAGATAAGTGCTTTTTGACAGCACAAAAAATACCAGAATCTGTCATTGCGTGTG
ATACATACAAACTCCCCCGAGTTTCGAAGCACCACATTCGCAACGGAGTGCTTCCAACCTCATTGCCTTGCGACCCTTTGGCAAAAAGGGCCAGGAGACA
CTTAATAAAATGAAGGGCCACCAACTCAAAATTAGTATCTTTTATTTTATGATGAACTCTTTTCTACACACCTTGTTTTATTTATTTTCACCTTTTGTGA
GATCTAAAATTTGTCAGATTGTAAATACATAGATGTAATTGGTCAAAAGCGTTTTTCAGGCAAACGCGGCACAGACAGCAGCTTTTGAAGAACTATTTTC
ACATCTTGTAAGAATCGATCTCTTCTGAAAACCTCAGCAATTTTCCAACACTGGGAAGCCCACTGCGAAACCAGACGTCCACCCCGTCAAAACGAATGAC
GCTCTTTTGTTCTGTACTTCGTTGCTGTTTGACTATGATCTACCAAAAAAAATACTGTTTTATAGAGCTAAGGCAGGGCTTTCCGTAGTGGGCTCGTTTA
GCTAAATCACACCATTAGTTTAATAAATATGTCAGCAAAGGAGAAGTGTTAGATTTGAGATGGAACAGAGTGGTATCAAAAGATGCAATTCCGTCGTGAC
GAGAGCAAGAAGGGTCAGTTTATTCAGAGCGGACTCTGGTATTACAGCCGCCACCCCAATTACTGCGGGTTTTTTTTCGTGAGCGTGCACACACTGCCGA
CCACGGTGCTGAAAGTGTGGGCTGGTGTGAGCCCCGTGTTCGTTACATTCTTGCTTATCTTCGTGTCGGGGGTCCCGCTGCTAGAAAAGCAGGCCGAAGA
GCGCTGGGGGGAGACGAAGGCGTACCAATAGTACAAGGCACAGACGAGTGTGCTGCTGCCCATGTCCAAGCGCAAAATGAAGACGACGTAAGGGAGAAAG
AGGCATCACACCAC