Description :
From Genome Similarity Track
Location :
Scaffold_41:42775- 49116
Transcript NameFunction/comments
Sapdi_VS20SDRG_11342hypothetical protein
Sapdi_VS20SDRG_11343hypothetical protein

Sequence
6341 bases(100 bases per row)
GGCGTCGAGCAAGGTCCGGACAAGCGCTGGTTTGCGACGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGCTCTCGATGGACCACGTCAACTACGAGATCCGCGTCGGCAAGATCAGCCACGATGGCTTCAGCGAGCGCTGCAAGCAGGCCGGCAACAACGGCGCGTG
TGCTGAAAACACCTTGTACAACTACGACGGCGACGCCCGCGGCATGACGACGCAGTGGATGAACTCGGCCGGTCACCGCGCCAACATTCTCGGCAGCGCG
TACGACAACGTCGGCTTTGCAGTCAAGAAGGCGTCGGACGGCAAATACTACGCAACGTCCATCTTCACCAAGGACAGCCGTCCGTGTGCCTAAGCACGCT
CGATGATATATGTCTGGTAATACATTGTATCGTTGCCACTGCAGCAGGTTTAAATAACGTTACGCTTGTGAAATACTGCTCGTGTTCGTCTTCGGGTGCA
TGCGCGGCGACCTGGCACCTAACCTCGCGTATCGCGACGAAGGGGCCGGGCCATTGGCACCCATGGCTCCTTACACGACGCGGGGGCTCGCCGGTGCCGA
GTCTCTAGTTGTGTCTGGTTTGGTCAAGCCATGCCATGCCAATGCAAGCGTGTAGTGCTGGAGTGGTATGACTCCAGAAAGAGAGTAGCCAAGAGTCTTG
GTAGTCTGTGTGCGTGGTGTGGATAGAATCAAGGGTATATACCCTTGATAGAATAGTGCTAGGAGCCATGTGCGGACATCATCACTGCCGTATATTGTGA
CCCTACTAGTACCCCGCAGTGACCCAACATGGATGGAGCCTCTTGAGGATGGTCTCATGCGGCACAGCCTATCGTTCTATCCACAACACCGGCCTTCATG
GTCTTGCTTACTATTTCCAAATCTGCGAACACAATGCAATTGCCTGCTTCCTCGGAGATTGCACTTCCCTCGCTGCGTTGTTTGCGCTGCACAGCAGAAG
CCACCACACTTTTCACTTGGTACACTACGTATGTTGGACGCGAGGTGTGCTGAGGGCAGCGCCCAGCACACGCTGCAAAAGTAGTATACTTTTGGCCTGG
AGTGGATGCCGCTGTGCTGTGAGGGACGCTGTACCGTCATGTTGATCTGGCGACGCTGCAAGTGAACACACAGCTTTGCTTCCCGTCCAATTAAGAGGGT
GTCCTTCGATGCCTCTAATTGCCTCAAATGTTTCGGCCGATCCGCCATTGGACAGTTCCTTACTTCATAAAGATAGGGGGCTGCTGCAGGGCCAACCCCA
AGCCCACAAAGAAGCCTACGGTTGTCCCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGAGTTCTATGCTTTTTAGACAAAGGGCACTGCACACGACCGA
CTTGTTGATCCTGGTGGCAACGCCAATGGGGAAGAGAATGAAGCAGGTATCACGGAGTGGACAAAAGTGGTCGACTAGGTGTTCATCTTGACAGGACCCA
AGGGGCTAGCAAGTACTACGCAACATCACACGTTTCGATTTGCTCTTCTTACACAAAGTAAGAATAATGAAATCGGCCTAGACATAGGTCTTGGGCACCA
GCGGCGCCTCTTCGCCGACGTCGTTGTTGTTCCAGAGCAAGACGTTGGCGCCGTTGTCGTTCCAGAGCAAGACGTCGCGGACATGCCAACCGGGAAACCG
GAGGAGGAAGAGGTGCAAGAGGTAATAGCACGTCGTCGCATTGCCCAAGAAGACAAGCCCGATCGTTAGGGCAGCGGCAAATAGCTTGGCGTCGCGGCCT
TCGCGCACGAGAATGTACGTGAGCACCATGCACTGCCCTGTCCATGCGTCGATGAACGTCGCGTACGCCCACGCATCGTCCTGGATCGTCGCCCAGCCGG
TCGCAAACGACTGCGCCTGCACGCAATAGACAAGGAATCCGAGGTACCCGAGAAAGGCCAGGAGTGCCAAACCGATAAACGTCCGGCGGGACGCCGACGT
GCTGTCGATGGGCGGGAACGCCGTGCGCACGGGCAAAACGGCGGTGCGCAGCGAGCCGTCGCTACGAAGGAGGAGCCAGATGAAGGCAGCGACGGTAAAG
ACGTTGCCGAGGACGATGGCGCCGAGGGCCAAGCCCATCTT