Description :
From Genome Similarity Track
Location :
Scaffold_314:4277- 6609
Sequence
2332 bases(100 bases per row)
TCGCTGGTCAACAGCACAGCTCAAGAGGTGCCCAGCTGATCAAACAGTCGACCAGTCGACTGGTCATGGACACCTGGGAGCTGTTAGTTTTGCTGAAGCC
ATGTCACGCGTGACTGGAGCCAGCTGGGGGACCTGGAAATTTGATGTGCGCCGTGCGAACCAAGCGTCAAGAATCCAGACGGCGTGTCGAATGTTTGGCG
CTACTACCAACTGGAAAGGCTATGGCGACGCCAGCACCACAGAGCAAATCCCATTGATGAGCACCATGAGCAATGGCACTGGAATGAACATGGCGTAAGT
CGTAACATGACATAATAGGCAGGAATCCAGTCGATTGATCCCTTACGCCAAGGTAGAGTGAGTACTGTGCTGGAGGTCTGCTATCCTACTGCATGCAGAA
CAGTCACAACGGAAACACATCGCGAAAGCGATGCGGCTCTCTCGTAATACAGTGACACAGAGGTGTGTAGTGGCAGTGACAGTGTGGGATGTCAGGTGGG
CGTGGAGCCATGTGTGTTTGCCGAAGGCCACGTCCGATCTTGCTCTCTCCTTCGTTCGCTGTCTGTCCCCAGTGCGGTCTCTGCGCAACGCGCTCTCCGT
CCACAAACACTCGAGCCATCTCAGCGTAGAAGAGTTGGGAGGAATCCCTTGAAGCAGTATCTCTTCGTTCATATTTCATACTAGCTGTAGTGAGTTAACA
GACAAGTCATCATATTGGCTGTGTCGTTGCCAAGCTTCCTTCCTTGGCGTTGAGCTGTACTGTCGTGAGGTAGATAGATGATTGGGCGACCGGCCGGAAA
GGCGGAGCGAGTGTCCTTTGTGCGGCCGAATCACTGGTAGAGTTTTGGCGGATTCTCTAATCGGAAGCGGCGATCGGACGCGCGTCTCTGCAGAGGCGTC
GTGGGCTCCCGTGTGTGGTTCACAGAAGAAGAAGAGACGAGCGCCTGCTGATGACTCCGCTTCAGCTACACGGCGAGGTCATCTCTGATCTCCGCCCGTC
AGCTCATGCCATCGTCCACGTTGAAGATCTTGGTTAGTAGGGTGTGGTGGTTGGTGTCCGTCCGTCTCCATAAAAAATAGAGTCAGTTCTATGTTCTGAC
TCCCTTTCTGAGTTTTCTCAGGTGCGAACGTAGCGGGGTGGAATCAGTCGCCGAGAACGCACCTAGAAAATCGTAGTTAAGTGAGTGACTTTAGTTGTAA
GTATCCCACACATTTATAACACGAAACTTTTGTGACAAAACTCTGGACACTGTTTGTATGGTGTTTGCTATATTAAGGTGTCCGGAACATGCGCGAGTAC
GCAGCAAGCGAATGCCGCCAAACGATGATCGATGTATGTGCATGTGAAGAAGCCCATCAATCAGCTGCCCTACTGTTGTCGCTATCGACTAAACGGAGAG
CGCGCTTGATGCAGATGCGTTCGAAATGCGCGAGTGAGTACTGTATTTATAGCCGCAACTGCAATCGTTACGCGCTCTGCAACGGACGACATGTGCGCGG
GCATTGTCCGCCCGCCCATTCGCCTGTCTGGATATGAGAGGAATGTTGTTTGGGAGAGCAAATAATAAGACAAAAATTGGTCGCTCAGCCCTGCACAATA
CAACAGCGCGCATGCTCCAGTGGTGATGGCGACATGCTGTGCGCGTCAAGAACCCAAGTCTGAGCAGTGAGACGGATCAGCGCAATTAGGTCGACGAGAA
GCCATGACTCAACGGATGTCACACGAGGTTTGCGCTCTGTCATTCGCTATTAAGATGGATAATGCTCGCGTTACGCTTAACGACGCGCCCTTTGTTTGCT
TGCTACATAGATGCAATCACCCGGCTATCGCGAACGAACATGCAGCGAGCAGCGGCACCTCCTCGTGGAGCTCGAGCTGGACGACTCGGTCGTGCTCATG
CCAGCTCGCGTTGATAGCCATGCGCAGCAACAGCGACACGCTTCTGCACACATGCAAGCTCGAGATCAAGGGAACTGGCGAGCGTCTGCAGCTGGCGCGT
ATGAAGGCGGGTCAGATCGCCATTATCCGCGATATGCCAACGATTACGCTGCGTTTCCTGATAAAGAAGTGGTGTTCGATGATCCAGCGGCGGCGTCTCG
CAGAAGTGCACGTCCTCAGTCCGCGAAAGCCCACGCATCTTGCAGCGATAGCACAATACCGTCCCACAGCGCGCAGAAGAAGCTGCTCAGTCCGTACAAG
CTCAAACAGAAGGTGCTCAGCAGCCGGCATCAGCTAGATCTAACGCCCGTTCCAGCCGAGCACGAAGGATACCGAGCAAGTCGTAACCCAAGGACGACGT
CAAAATCGTCACCTCTCGCGCTGATCGCCAGC