Description :
From Genome Similarity Track
Location :
Scaffold_206:42758- 44817
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_206-snap-gene-0.24PIH1 domain-containing protein 1

Sequence
2059 bases(100 bases per row)
TGGATCGTAGCTGCTGGACGAGCTGTGTGAGAAGGACCcGCAGGCGTATGAACAGTTCATGCAGATGATgCGGGACcAAGTGGCTGCCGCTGGTGGCGCT
GTGGCTCCTGCTCCTAGCGCAACACCATCAATGATGGATATGATCAAAGGCGCTTCGAATGGAGCTGCACCgCCAGTGGATGGTGCACCCACACAACGTA
AGGCaCcATGAGAAGGGTTCGATAAAGATCGAGAGCTCATTTGCAAATGGCGTAGCGTTCAAACCGCAGTTCCCAGGGAaCAAAGTCATGGAAGCAGACG
GGCTAACAGCCAAACAAGAGGGTGTACGTGGCTGCGTGTATCGTAGGAGTCGGTGGTCGCTGACTCGACGACAGATGCATATTGAGGTGACGCCAGGGTT
CGTCATGAAGACCAAGGACATGAAGACACAGCAGAAGGTCTTCGTCAACTTCTGCTACTCCAGTGCAATTCAGACGTTCTCTCAGCGGAAGCAATTGGAT
GACCAGGGCAATGAGCAGGAGGTGAGCTACATGTGCATCGTACTGTATTGAACATCAGTCTGAGAGAGCGTGTGAACGGACAGGGGCTTCATGTGCCGCT
GAGCCTCGGTGCTCCCCATGAGGTCGAGGACAAGAGCGGAAACAAGTCGCTTGCGTTCGACGTTGCTGTCAATACGCAGGTCATCGAAGACTGCAAGAGC
GACAAGACGGGGTCCTTCCGGAACTTCGTCTGTGAGCTCGCCATCGAATACATCGATCAAAAGGTACTATGCTTACTTACCGCCTTAGTTGGTTGATGAG
CACTCATAATGTGAGAGTATTGTAGTACAAAATCACACTGGATGCGCGATTCAAATTGCCCAAACTCACGTACAGAGGAGAGCTACCACCACCCAAACAT
TACATCAGGAAGGCGCAAAAGCCGATCATTGAAGAAGTCGATCGGCCAACGCCTAAGCCCAAGACTCTCAAAGAAGAAACGCCAAAAACTGGAATCGCGA
GTGTTGAGATCTTCGAGTTGACGCAGAGAGACGATGGACGTGGAAGCCGCACCAAGTGCTCGCGagTTGCTGCAGTTGACGCTAATGGTGTCGCTCTTTC
CAACGAGATGCTACACCACGCTGGATCGCATCTCGCGATCCGGGTGTCGTTCCAGTGTCCTGTAGTCGATGTCCAAGATATTGAAGGAATCGAGCTACTA
CCAGAACACTtGAaTATCAAAGCCAGAGGCCACCAGGATCTTGGTACGTCCCTCTCCACTGTACTGGAGCAGCCACAGCAATGATCTCacTCACGCCATC
ACTGTAGCGTTTTTCCTGCCATTCCCGGTAGTGACGGAAGAAGCAGAAGTTACATTGGATAGAGTCGGGAACGCGCTGGAGCttgttGtGCCAATCGATA
AATCATGGtCcGAGAGCGAACcGGATTGTGGCTCTGCACCGTGGCTGCTTGCCcAGGCTCTGCGCGATGAAGACGATGTCAAGACCAAAGAGAAGAACGA
ACAAGTCGCTGTGAGTCAACCGAAGTCGCTTACGGAAATGTTCCATTTGGCAATGCCCCAGTCGACAACGAATGGTGTGAACGACTCAAGCAAGGAGTTG
AATAGTGGGGTCAAGTGGGATCCTGTAGACGAGGACGAGGAGCTGCCGGAAGATCGTTTtCATCGCAAAGATATGATGTCGATGCACATTCTGGAGCAAC
GCAGGAAGGAGCGACAACAGAAAGCCAAAGAAGCCGACGAAAAACGCAAAATCAAACGGGCGGAAGTCGAAGAGAAGCAGCGCAAGGCAAAAGAAGCAGG
AAAAACGTGGCGAGAGATGTACCCGAACGAACCCGAGACAACATACATTGACATGGATGACATCATTCGAGAGGAGAAACTGCGGCGGGCTACGAAAGGA
GACGAAGAGAAGAAACAGGAGCAGGAAACACGCTCGAAGGAGTGCCACGCGACGGAGAAGGCCAAGCAAATGGCAGCAGCGTGGTCGGAGGAGAAATTGA
CGCACGGACTCGACCTCCAGTCAGCtCTTGCATTCGATCTGCTGGAGTAGAAGCTGCAA