Description :
From Genome Similarity Track
Location :
Scaffold_30:427573- 438037
Transcript NameFunction/comments
Physo_134210hypothetical protein
Physo_134211epsilon-adaptin, putative
Physo_134212WD40 protein

Sequence
10464 bases(100 bases per row)
CGCTCACGTTGGAGTACGTGCCGTTCAGAATGGGCATGAGACCCCGCAAGCCAAAGTCCTGCGCTTCTCCCTGCCGCTGCAGCTCCGTATCTGAGTCCGC
CGCGGCCGCAACACTGAATGCGCCGCACAGCAGCCCTGCGACTACCGCAAGCGGCAGGAAGGTCCGACCTCGCGTCCTCGCTGCGACTGGCGTTTCGCGT
AGTCGGCAGCGCATCTCGGCTGCCTGCGCTCCGCGGGTCGAGCGGAGTTGTCCGCTAGTGGCCACTGGCGCATGGGCCCAGCGCATGGACAGCTCCAGGT
GTTCGCTATTAATACCCTCGCGTAATGTCAGTCGGTCGAGGTCGAGGTCCGCGATTTCGGCCAATCGCAGAAACGTCATCAGAGGTCCTGACATACAAAA
ACCAAGGCAAGAAGCGATTTGCGAACTTATCAAACCATGGGAATCGCGTTGGACACTCTCTCCGTCTTGCAACAGCACACGCGACGGTCTGCAGCTCACA
ACTGCCGCAATCCCGACATTTACAACATGGGCAGAATCATATGTATATTACGCTGCGCTCTTGGGCACGATGGTGCCCAGCGAGGCACTGTGGGTCGCTG
CTATCAGAGCGCAGCGCACCTCTTGCGTTATAATCTGTGGAGCCCGTCGCCCTTGGTCGTCGGGATGTTGCCGCCTCCCTTGCGGCGGCCCTGCAACGAC
CGATGGCGCGCCGGTCTCGAATACACACTCACTTTCACACACACAGATTGGGAGCCCCAGCTTCGCCGTGAATTCGATCTCCACGCGCGACTGGCATCCG
CACTCCTTCCTCTCCCTGAGGCCTCTCCTTCCGTCGGAGAGACCATGATGCGTTGGGGAGGGAGAGCAGCCTAGTAAGCCTGGCAGAACTTGCGCAAGCA
ACCCGTGGTGGAGAGCACCCGGTCGGAGCGCACAGCGTCGATGAACGTCTGCAGGCGTGCTCGGCGCGCGTTCAGCACGTGGTCCGTTAGCTCGGGCTGC
ACGAACAGCACCGCGCCGCTCGACAGGTGCGGCACCTTGACGCTGCGCCACTCCTTCTTGGTCTTGACCTCCCTCTTCAGCTCGCGCTCGAGCTGCTTGA
ACTCGTCGAACGAAGTGGTCACGTCCCACATGATCACGGGGTTCAAGTGCTTCTCCTGAGTAGCCGACTGGGCACCGCAGTCCACGCGCACGACGTAGAT
ATCGCGCGGCTTGCGCTGGCCGGGTACGGCCTGCATAAACGCCTTGCCCACACGGATGTTGGCCTCGCCCAGGTTCATATCCACGCGGCGGCGCATATCG
CCGGGCACGACGTTGACCAGCAAGCGGTTCCTGTTCAGGTGCACCAGCACACGACGCCGAGCAGCCGGGGCCTGGAGCTCCTTTCTCTTGGAGGCGGCCG
CATCGTCTGTCTTGCCGACATGGGTGGACCTTGACGAGATAGTCGTGCCATCAACGCAGAGCAGCGGGAGTGTCGGAGTCGCCGCCGCCTTCTTTTGCGG
CTGCGGCGCGTACGGGTAGCTTCGGACGGGGGCTGTGTCGGGCACGACGGCGTTCATGGATAACATGGCGAGCCCCATGAACGTGTAGAAGCTGATGAGC
GCGAACGCGGCGGTCTCTGCCAGCAGGGCCAGCACGAACGAGAGGATGTTCCACGCCAGCACGCAGGCGACGTAGGTGGCGAGCAACAGCGAGGCGGCCG
AGCTCAGGGTCACGTCAAGGTGCAGCAGCGAGTCGTAGGCGCTCGTGAGCACGGCCACGCGGACGCCCGGCAGGTTGAGTACGATGGTGGGCTTGGCGTT
GTCGGAGCTCACGGCCCGCGCGCGCGGCTTCATGGCGTCCGTGTCGGGCTGCATGGCGGCCTCGAAAGTCTTCGCAATGGTGCGGAGGAGTCGTACGTTC
AGCCCCCGCAGCGGAGCCTGAACGTCGGAGCGTGGGAAAGCGTGGCAGTCACAGCAGGCGGCTTGGAATTCTGCTGGCGCTTGCGATTCGTCTCGGGCGG
CGTGTAGCAGCACGGCCCGCGCCTCGCAATGATGCTTCCGCTCTGTTGATGGCTCTCCTGCGCGCTGGCCTGTCTTTTGCGGATTGGTGGGGTGCATTGC
ACAGGTCATGCTGATGATGTTGATGAGGAGCAGTGAACTGGCTTCAAGTTCAACACGCGCCGCTTCGGGTCCCAAGCGGAGACCGACGCTTTTTGTCTTG
TCTTGCTGCCGGACACGAGGCCACCGGCGCTAAAGAGGAAGAAGGAGGAAATGGTCTCTCTATTCGAGCGGGCAGCAGTCGGCAGCTCCAGATGCTCGTC
GCCATCGCAGCTCAATCGGGGCGGAACTGATTAGGCCAATCGCACGCGGAACTCGCAGGCTAGCGTAACGCAGCGTGGCTGGTGGATTCTCCATCCCCCA
CACATGTTGCCTCAAAGCCTGCTGCTGTTGCTCAAAAGCAAACTCTTGAGCCAGCCTCCCTCAAAGCTAGAGGAAGATTGGAGATGCCATTCACATGAAA
CATTTGCATTTTTGGCTGCTACAGTACTTGCTTGGCCTCCTTATTTGAGTCGCTGCGCCGCAGCCTCCAGGAGCTGGTCGGTGAAGTTCATGTCGGCCGT
GCGGACCGTGAGGTCCACGAAGCCGCCACTGCGGACCTTCACGTGGATCAATCCTACGTGCTCCGAGTTCACCAGACGGCACGCTGCAATCGCCTCGTTG
GCTGGAGTAAACAAAAAGCGGGACAGAAGGCATGACGTTAGAGCTGTGTCACGCAGAGCAGGCACCAATGGCATCAATAGCATGGTACGTACTGGCTGGG
ATGGCCTCAACGGTGTGGACATTGAACTGGTGCATGCGACCCATGAAGTCCTCGAGCGTGCGGATACCGCTCGGGTTGACTTTGGTCTTCTTCTCGCACG
GGCAAGTGCCCCAGCGTCCACCAAAGTCCTGCGTGGTGATCTGCCACGGCTCCAGCTGCCGTCCGTTGTACTGGAAAACGCTCGTGTTGCTGCTGCTACC
GCCCAGCATATCCAAACCGGTGGCGCTCCTGCCAAGCTCGACCGCAGCTGCGCATGCAAACACAACAACAAAACAAAACACAGCGAAGCAACGATCAGTG
CACAAGCCATTGAGTTCATCATGACAGCTTTTGCACGAGCTTACCGTTCATGCTGGAGCCGAGTCCCGACATGTCGAACGGGTCCAAAGATGCAGAGGGT
GCTGGTGAGCTCGCCTCGAGGGCAGGCGGCGATGCAAGCGGCGAGCCCATGCCAAACGGATCCGCATTCATCATCGGCTGCTGCTGTGGAGGTGCCTGCT
GCTGCTGGAACATTCCTGTATTCTGTGGCGCTGCAGGGGCATCGAACGAGATATCGAGGAGGTCCATTTCAACCTTCGGCTGCTGTGGCTGCTGCGGTGG
CAGCGCTTGCTCCACAGGAGCTTGGGCCTGCTGCGGTGGCTGTTGCGGCTGCGGCTGCTCGTTACGACCCGATGTACGTCTCGACGAAGAGCGGCCGGAA
CGACGGCTCGAGTTGAGGGTCGAGCGAGTGCTGGATCCTACACGACGAGCACCAGGCATCGGTGCCGGAGCACCAGGGATGCCACCAAAGATCGCGGAAG
CAAGCATCTGTCTCTCGTCAACGCCACCGGTGGCCTCGTCCTCACTTGAGGGCTCGCCATTGTCGTAGTTATTGTTGTTGGGAGCACCGTACTCTTGCTG
AGGTGGCTGCTGAGGAGGAGGCTGGGAACCATATCCTCCCTGGGCACCATAAGCAGGCTGAGCACCGTAGCCGCCACTCTGACCACCGTACGCACCTTGG
CCACCCATGTTGCCCTGGTTGTAAGGGTCCGACGGATACCCACCAGGACCACCAGGACCACCAGCTCCAGGGGCCCCAGGCGGGGCATTGTCGGGCGTGT
TGAGACCTGTGGGGCCCCACACGTTCTTGACAACTCCACGCTTGCCAGCACCAAAACCACCGGTAGGGTCCGGACCACCGGAGCTTCCCATTCCGAGCAT
GCCACCAGGCCCAGCAGGTGCACCGCCCCACTTGTTGACTCCGAAGGCGCCCTGCTGATCGGCAGGGGGAAGTTTGGTCGGGTAAGGGATTTCAGGCTTC
TTGTACGCCTCGAAGTTCAGGCGGTTCGAGTCACCACCGTTACGGCGGTGGCCATAGCGCTCCTCTTCATCGTCCGAGTCCTCAGGCGGGTCGTAGAGCG
GTGCGCCCTGCGCAGCCGCCTTCTCCACGAAACTCGTAAGGAACGAGAGGTTGGGGTCCACCTCAATGTCTTCGCAGCTCGCGTCTTCCGGGAACACCTC
GTTCATGAGAGCAAAGTTCTTGGTAAGCGCCAGGTACTCAAAGCAGCGCTGCTGCAGATCCGTGCTACGGCTGGTCTTGTACTTGTCCATCATAGCATCG
GCCACATCAATAGTGTGACCCATCTGAGCCGTGATCTTCGTCACAGCCGAGAGCACGTAACCACGCGTGGTGTCTTCCTGGTCGAAGGGGCGGTCGACAA
GCTCCACGAGACGCTCACAGATCTCCTCGAGTTCCATGGCATCCGAGAGGTAGCCGTACTCGCCAAGAACCCAGGCCATAGTGCAAACCAGAATGTCAGG
AAGCACGGGGCGCTCCAGAAGCTCCAGGTACGTGTCCACGGCATCACGGCGCAGTTCCATGTCCTGGTCTTCGTCTTCACCGCTTCCTTCTGCGATCAGA
CGCAGCAAGTTGTGTGCCACCTCAGGACGCACGAGGTCTCCGCCCAGCTCGAACACGTTAGTCATCGTCTGAATGTACCAAGCGTTGCTCGGTGCGTAAC
GCTCAGCGCACTGCGTGATACGCGAGACAAGCTCAGTACGGAGGAAAACGTCCGAGGCTTCACGGAGGAACTGGGTGAGCTTGTCGGAAATGAACTCGAC
GTTCACAGGGTTGGTCATGCGATACAGCAGGTCCAGCGTCTTGCGCTTGAGGGTCTCATCCGGGTCTTCAAGGCAGTCAATCACCGCCATTTGGTGCGCC
GCAGCGTAGCGCGGGTGGTCCTTCACGATAGCGGCAAGTCCCGTAACACCCAGGTACTTCAGGTTGTGGTTGTCGCTCGATATGAAGCGCGAAATGCTAG
CAGCCGCCGCGTCGAGCAGCGTGCTGTTCGGGTAAATGGTCGTCACAGTCTGCACGCACTCGTAAATGATAGCGTAGCCCACGTTGATCCCAGTGTCAGC
ACGGCGCATGACATCGTGCAGCACCTCGTACATGCCCTCACTAGTCTGCTGGTCCGCCTGACCGAGCAGAGCCAGGATCTTCAGCAAACGGATCTGGATC
CACGGCGCCGGAATGCGGTGGTAGTCGAACTCGCGCGGCAGCCGGTGCTCCGTGATCTGCTTGAGAATGCTCACGAAGCTAGGCACCAGGTCTTTGTAGT
CCGTGGGGGTGGCTTCCGCCAAGTCGTGCAGGATGCAGAGCGTGGCTCCCATGACGCTAGGGTCGCGGTCGCACAGCGTGCGGCGCAGAGCATCTCCCGC
CTCGCTGACCGAGTCCGGGTTGAGCTGGTGGAAGCGGTGGATAGCCATCACCGCCTTCTTGCGCACGAGCTCGGCGTCGTGGCGCAGCAGGTCGAGGATC
ATGGGCTGCACGGCCGGCACCATCTCCACCGTCACGAGCTTGCAGACCGCCATGAGCGCCGCGCAGACCTCGAGGTGGTTGGAGCTCTGCAGGTCTCGCT
GCAGCTGGTTGATGATCATGAAGCGGAACTCGTGCGTCGGGGACAGGCACAGACTGCACGTGAGGTAGCCCACGCGCTTCTGCATGAGGTTGGTGCTGGC
CGTCATCTCCACGGCCTTGATGTAGCCGAAGGACGCGTCGTGGCCCAGCATCTCCACGTACATGAGGCGGATGAGGAACTCGCGCTTGCGCTTGTTGACG
AGGCTGCTGGACGTGCTGGACGTGGCCGTCACCTCGCTCAGCTTGCGCTTGAGCTGCGCCACCTCATGGATGATGATGCGGTCCTCCTCCTGCTTCGACT
TGCTCTCGCCGATCGACTTGACCAGCTCGAAGAACTCCTTGGACAGGTGTCCGCCCGACATGCTGCTGCCTCGTCGTGCGCGGGGAGGGGGTGACGTGGG
CGATCTCGGATTGAGGGCGACACTGCAGTGTGGTTGTACGATAGCTATCGGACCAGTACTTGAGGTAATACCGGTACATTTTGTGGATACCGTCATACTT
CACTGTGATTTAGTATGCAGTGGTAGTGGTCCGTTAGTAAACTATGGTAAGGCATATTTGCGGGCTTTTGGTGTGGCATACTGTTTGTTGCTCGCGAGCA
TGGTGGAGGGTGTGGAGCTCTCGGACGCCGTGCTGCGCTCCTACAGCGTCGCGCGCAACTTCGCCCCGCAGGTACGAAAGCGTTTATTGACTAGCTGCGT
GTTATGGTTCCGCTGCTCTGAGGTTTACTTATCGTCTGCCTACGCAGGAAGACGAGGATCCGAACGTCCACATCACGTCGCTGGACTTCCACCGCAATGG
CGAGCGATGCGTCACGAGTCGCAGCGACGGAGTCATGTCCATGATCAACTGTCTGAGTGGCACGTACGTTGCAGGCAGCATGGTTGATGTAAATGTGCAT
TGTGAATGAATTGACACGGGCCGATGGCGATGAACAGGGTCGCCAAGACAATTTTGACCAAGAGATATGGCGTCGGCCTCGTGCGGTTCACGCACCACCC
GGACTGCGTGATCTTCTCGTCCGCGAACAGCGCAAACGATAGTACGTTCTACAGCTATATCGAGCGCCTCGTGGTGACCAGGCATCTGACGGCTACTTGA
ACTTGTTTCCTATGTTCACAGATCGCATTCGATACCACTCGTTCTTTGACAACAAGTTTCTGCGTTACTACACTGGTCACACGGACAGGTAGGCTATACT
TGCACGTTGAAGTTGCTCTTCAGGGGCTAACGACTCCAATGTTTGTTGGTTAATAGAGTTACGTCGCTGATGATGCACCCCACCGCGGACCAATTCCTAT
CCGCAGGAATGGACGGCACAATTCGACTCTGGGATATCCGCAACTCCGACACTACGGTATGGACATAGTGCGTTTTTAATTTTAACTCTAGATTTATCGA
TGGTAACTAATGATTGATTTCCTTAGGCTATCATTCGAACTGATCACTTGCCAGTTTCGCACGTGTGCGCCGCGTATGACCAAGAGGGTGTGGTGTTTGG
TGTTTACACGGACGACCACTTGATCCGCATGTATGATGCGAGGAACTACCAGGAAGGACCCTTTGCCAAGTTCTCGCTATATGATGCGTCGATCATGGCA
GCAGTCGAGCCCTTCCTCGCGCACATGCAGGCACCCAACTTGAATGCGAAGAAGCTGCACGCACTTGACCTAAAGTTTAGTCCCGACGGCAACCAGTTGC
TTGTCACGACAAACCGCGGGGTGTTCATTCATTTGGATGCGTTCGAGGGCAAGCTGCTGCACACGTTCAAAGAACACTGGTTGAGCCAAAGCCAGCGTAG
TAATCCCCAGTTAGGGTGCTGCTACTCTGCTGATGGTGCGTATGTGGTCACCGGAGCGGAAGACGGGCGGGTATTTTTCTACAAGAGCTCAACTGGTCAA
TTCGTCCACACACTTCCTCAAGGTCACAACGGCCCAGTTATGGACTTGCAATGGAATCCAAAGCGCCATCTTCTAGCTAGTGCTGGGGGCAATTCGACGG
TGTTGTGGTCAGCGGCAGGTATCTGAGAACAATTCAAAAGCTCTCAATATAATGTGAGCAGTGCAATGGAGTCGACTTCTTCCCCTATAAGCCTTCGCAG
TAGGTAAAGTACTCGGAAAATAATTAATACTTCTGAAGTACCTGTTATTCCAGCACTATCGAGCCGTTGATACCGTACAGCCCCTATTCAACCCTGTTCA
GCTGTTGTTTTTCAACAGATACTACAGTACGTAGTATTCCAGATTGAATACTGCTGTGGGCTCAAGCTGCGAATCGCGCGCGCATGCTCGCGCTTGGATA
ATTCTAAACCGCTTCACCAATCAAACGGTCGTCGGCTACTCCCATAGCTAGTAACTTGCAAATGGACTGCTTATTGCCGCTGAAGATACGTAGCGTACAG
AAATAAAATCATAGCGCTGTAAGTTCATGTAGCAGACGGTAGTGAGCGATTGCGTGAGCACGTAGCCGCATAAAACCCCGCACGGTACTCGCAAATTAGG
ACCGCGCGGAATTTGCAGATACGGAAACCATTGCCGAGCATTCCAGCGAATGGGCCTGTTACCGCAACTCGGAGTAAGGATTCGTATTGCTGGGGTCTGG
GGAGTGCAATCCACAATCCACACTCATCTCAGAAGAAATCCATGAAGAAAGTAGCAGGTCCAACAGAAAGCAACAGCAGAACAGGGGTCATGACAGGTGA
ACAAGGGCTGTATGTGGGCAACAGCCGAACAGAGCTAAAGTAACAGCTCATAAATATCATCAAAAGTACTCGAATGCGGTGGTTATGACAACTGACACGT
CCTACAGAAATCGTTGAAGAGATGGATGCGTCAACTGCTGCCAAGTTCGAAGCTTCACTCTTTCCTACAGAAATTGACATCATACTGTAGCTACGTGCAA
GTGGACATGAAGATCATGAACGGTACTGAAATTTGGAGGAACACCCCGACACAGAGCACTACGTGTAGCGCGCAGGGAGGAACATATTCTTGGCGGGAAA
CGACACTGAAAGGGAAAGTGAGTTACTGTGATGACGAACGATAACGTTGCTGCTGAATCGCTTTAAAAGCGTACCTACCTACTACCGTGGCGGCACTCCC
TGTTGAAGGCAACCTACATTACAAGGGCGATAGGTACATACTGCGAAGTCTCCAATACATGCATGCACTGGTCCAGTACAGTACTACACTGGACCAACGT
GTAGGAGCACGTTGAAGGTACTTTACTACTTCTCTGGTCCACGATAATATGCGCGAATCACTTTTTCTACCATAGCTGCGCCAATTCTACTGGTAGCCAG
ACAAGCAAGGTAGCAACAAAAAGCTGAGATCGAGCTGAAGCACATGACATTTTTTATTAGCAGCTTCTGCGAGGCTTTGGCCGTAATACTATCGACAGAA
GCAGCTCATCTGGCGATGAAATTAGGTTTTTTTTCGTAAAACATAAACCACAATAGCGATATTAGATCGAAGAATTGTCTCGGATTGTGCTTGATACAAG
CTTTCTGATGAGCTCTGATTTAGAGGCAAAAGCGTTGATTTGTGAGAGCTAGAGCCTCGAATATAAACGAGGTTTTTCCTGCTTGCACGGTTGAGATTCG
CATTCAGCAATTTATTTTTGCCCAATCAGGACATAGCTCATATTTATGCTACGTTTAGGATGGCGTTTTAAGAAAAAGTTATGCGGAGAGTTATCTATAA
TACATGTGAATCATTCTGAAGTCTCACCCCCTATAATACAAAATTTGTTGTGTATTTTTTTCCTACGTGAGTCAGGGCGAAGGCTAGGCTTGTATTATTG
GCTTTTGTAACACTGTGTTGCCGCGAGGTATGCCCGTAGCGGCTACTGGGCAACGCAGTGCTTGCCGTTCGTCATAGGGACGTCCTGGATGAGCCCAGCT
ACCTCCTCTACTAAGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN