Description :
From Genome Similarity Track
Location :
contig_120:42751- 44308
Transcript NameFunction/comments
g13410.t1XP_009533065.1 hypothetical protein PHYSODRAFT_563428 [Phytophthora sojae

Sequence
1557 bases(100 bases per row)
GTTGTAGTACACCGTATTCTCGAACTCCGGCGCACAGTACGGGAACTCCGCCTCCTCGTCCGACGGAGCAAACAGCTCCTTGCCCGTCGTGTAAGTCACG
TAGCAACCAAGCACAAAGCAGATCACCACCACGATGCTTCCCGAGGCCTTCTCCCACATCGCAACCTCGCCCCACGACTTCTTCAGGTAGAAGACGATAG
GCAGCAAAATGCAGTTCACCGTGATGCACGAGGCACCAACGAAGTCTGCCAGGGACGTGAAGTCGTCCTTCAGCACAATCGAGATAACGACAAGCACCAC
CACGAGGATGACACGCAGCACGACGTACTTGATGGCGTTCGCACCGCGGTACTCCATCGCTTCTTTCTCGGCGTCGTCCTTGTGCACGTTCTCGGCGTCG
GCCACCGACACGTACGACATTTTGGAGCTACGGACAGAATCTTTCACGGCCGGGTCAGCCGGGGTAGACGTGTGCAAATAGCTGGTGGCGTTCTCCAGGT
CCTCCTGCACCTCCTTGTGCATGCCCAGGAACAGACGCTCCGCGATGTAGAACGCCGGGTTGATGATCACCGCGAAGGCGATCGTGACGTGCAGCTGCAT
GAAAAGGTATGCTAGCACGATGGTTCCCCAGTTCGGCGCAAAACCCAGGTTGGTGAGGCCGGTCTCCGAGTCGGGGTAAATGGTGAAGAGCAGGTTGCCC
GAGATCTGGCAGCCCACGGCCGAGTACGCGGTGCTGGCCAGGACCAGGAACAGGATAGAAATGATGCCGACGGTGACGCCCACGACGCGTGGCATGCGCT
TGGGGTCGCTGTGCTGGCGCTGGATGTCCGGGATCACGATGCCAGCACCGTAGGCGAGCGATAGGTTGCCGAAGCAGCCAGCGACCTGTTCGAAGGAGAG
GTCAGGCGTCGGCACGCTCGGGTGGCCGCTGAGTCCGTGCATGACCACAGCCACGCCGAGGATATCGGCAATGATCGTTCCCAGGCATCCGGCGAAGGCG
GCCCCAGCTCCTTCCTTCAGGGTGGGCACCAAGCACACGGGCAGCACCATGAGCGCCATGAAGATGATCCACGTGGTCTGGCTGAAGGCTCCCGGGAAGA
GGCCATCCAGCAGTGAACCACCGAGCACCAAAAAGACGCACGGGATAAGTAGGCACGAACCCATTTGTGAGATGATACACAGCCAGCGACCAATCGGCCC
CATGCACCACTGGCCGAGGTCTCCAAATGTCTTGACGGACTTGGGCGCGAGCAGCATGACCTTGGACATGGTAATGGACGCGTAGATGTTGGCGAAGGCC
ATGAAAGCCATGGCAACAACGGCGAGGTAAGGGCCGGCGCGCGAGAAGTTGCCGGGCATACCAAGAGTACCAACGCCGTAGATGCAGCAGAAGAGGTTGA
AGGCCGACTTGGCGTCCTCAGCGGTGAAGAAAGGTCCCTTAGCCATGGTTGTCGGGGCGAAGGCGCGAGGCAAAAAGAACAGGGGCTACGGATCGAGCGC
GCTGCTGATCAGGGGTTGCTTGAGTTGGAGGCAGCCAAATTGAAAATGATGAGGTGG