Description :
From Genome Similarity Track
Location :
Scaffold_32:42750- 44997
Transcript NameFunction/comments
Phyta_totarag1637hypothetical protein

Sequence
2247 bases(100 bases per row)
CGCAATGGAGAGCAGAAACTGAAGTTTGCTGACTACGAGACCTACATGTTGTGTCTGCACCGCTTGATCCTGCCCGAGTTTAATATTGCTGCATCGAAAG
AGCTGATCATGGACGACTGGAAGCGAGATAGTGGCGAGCAGGATCACTTGGACTACGCTTTCTTTCACTTGTCAATGTTTGAGTTGGTTGGTGCGTGAAT
TCCTAGCTTTTACAGATTTTAGCCTCGGAAAACTTTCCTGATTTGCGTTGATTTGTGTGATCTGTAGATTTATGGACTGACACTGTCGACCCTGAAGACG
TACGTTTGTCATTGCTACTTCGTACAACAGTGAACGCATCTAATAGTTCTCCTCCTATGTGGTGTTGACAGTACATTTCGCTGTTATATTGCATTACCCA
CTGCCTAACGTACCTCCTTAATAAGCGCCACAAGCTGAAATCACTTGAAGGTAGCTCGGAAATGGTTTGTAGTACTTTGTATGGACTTCTGATCCTCCTT
ACCATGTGTGGTGACTTGCGCGTAGATATTTCGACTGTGGACATTTTGAAGGAGTCAAAGGGAGTGACACTAGAAGACATTAAGCAAGACTTGCAACGAG
AGATAAATAGTGACGCGTTCGCATATTATCGGGACCAGGTCAAGCTCGCAGCCGAAGCAAATGCGGAGCGAAGAGTGAGCAGACCTAGCAGTCCGAGAAG
AGAGTCGCATACTCAACAAGGCAGCAACCAAACACCgtcaagatcgaggagaaAGTCGCATATCCAACAAGACAGCGACCAAATACCACCAAGATCGAGA
TCGCGATCGCGCGACCGGAAGCATTCGCCATCAAGCAACGGAGAAAGAGATGGAAACGCTACGAAAGGTGCGTACATTCTGCCAATTCATCGCGCTGTTT
TATGGCATTCTTACGAGCAGATCTTGCTTCTTTAGACTTGGAGTCGACATCACAACACCGTCGAAGCAGATCTGGCAGCGGCGCTTTCGGCCAGGATGCC
CCGAAGCGCAAGTTTTCCGTGCAAGCCAGAACAAATGCGCTCAATCTCACAGCAGATACGTTTGGTACGATAGCTTTCTCTCTCACGATGGCTACGATAA
AACCATTCAACTGACCCAAAACATCAATTTCTTagtggttgctgcaggaTCCGACGGCAATCACGCAGGGTCTTCTACACAAAATTACCCTACTGAGTTG
TTGCCAGTGTCTCCAAGACGAGAAACCGCACTTCAGCGGGTGCAGTCGCCCAATGTGTTTGCCCGTGGGGGTGGAGTCATTCTCAGCATTGGCATGATGG
ATGGGATGACAATCTCTAAGACTTCTACCGACGGTAAACCTGCAGTCGCAGTATCGACAGCGAGCATGTCCGCGTTCCCACGACGAAGATCCCGAAGTGC
ATCAAACTCTAGTCAACATCGACGAGAGCAGATAACTCAAACGGTCTCCGGTAAAGTCGACAGCACTTGGGAGGCGTCCCTTTCAGCAGGACTGCAAGTG
AACCacattgaagcagcagggTCGGCCCTTCGCACGGGCACCGCTCAAGACCCAAACGCTACGGGCTACGTATTCATCCCGGGTGCAACTGGTTCAGGAA
AACCATTTACAGTtcgcgccgctgctgtcgcggaagcagcagccaatATGGCCACGTCGGCCGCCCCCGTGCAAACACTTTTACTCCAACGCACACCACA
CCAGTTGCAACAGCGCACGTCGCAGTCCAACCCTGACGGTATTGCCTCGTCCGTACCGGGTGGAGCAACGAAAAACATCCCACCGAACATCTTtatcaac
aacagcagcctGACCGCACCACTGGTCACGATCGTTAGCAGCAAGGCGTCAACTCAACACGAGGCAACGTCTTCGATCAACAAGATCCAGCTGCAATTCC
AAGAGAGCCCGGACCCATACACGGCACGACTCCAAACTCCGTACGGAGGTCTCTTAGGGACATCAATATCATCCCCACGATCCAGCAACGCTAGCACTGC
CCAAGCCGCAGGTATCTTCATTTCCACACACCAACGACCGGTAAAGCCTGCGATTTCTCCACGGCCAACCTTCCTTCAAAGCCCTGGAAGCATTTTGAGT
AGTGAACACCAGACCCCAACGAGTCCACGGAAATTGCAGAACCTCCAGCAGGAAGAAAGCCTGTCACTAGTTGCAACTGGCCCTGGATCAAACTCAGCAA
CCCTGATGCCACTGACCATTAGTGGCAGGCTGGTAGCCCCCAACAGC