Description :
From Genome Similarity Track
Location :
contig_120:42749- 44305
Transcript NameFunction/comments
g13930.t1hypothetical protein
g13931.t1XP_009533065.1 hypothetical protein PHYSODRAFT_563428 [Phytophthora sojae

Sequence
1556 bases(100 bases per row)
GTTGTAGTACACCGTATTCTCGAACTCCGGCGCACAGTACGGGAACTCCGCCTCCTCGTCCGACGGAGCAAACAGCTCCTTGCCCGTCGTGTAAGTCACG
TAGCAACCAAGCACAAAGCAGATCACCACCACGATGCTTCCCGAGGCCTTCTCCCACATCGCAACCTCGCCCCACGACTTCTTCAGGTAGAAGACGATAG
GCAGCAAAATGCAGTTCACCGTGATGCACGAGGCACCAACGAAGTCTGCCAGGGACGTGAAGTCGTCCTTCAGCACAATCGAGATAACGACAAGCACCAC
CACGAGGATGACACGCAGCACGACGTACTTGATGGCGTTCGCACCGCGGTACTCCATCGCTTCTTTCTCGGCGTCGTCCTTGTGCACGTTCTCGGCGTCG
GCCACCGACACGTACGACATTTTGGAGCTACGGACAGAATCTTTCACGGCCGGGTCAGCCGGGGTAGACGTGTGCAATAGCTGGTGGCGTTCTCCAGGTC
CTCCTGCACCTCCTTGTGCATGCCCAGGAACAGACGCTCCGCGATGTAGAACGCCGGGTTGATGATCACCGCGAAGGCGATCGTGACGTGCAGCTGCATG
AAAAGGTATGCTAGCACGATGGTTCCCCAGTTCGGCGCAAAACCCAGGTTGGTGAGGCCGGTCTCCGAGTCGGGGTAAATGGTGAAGAGCAGGTTGCCCG
AGATCTGGCAGCCCACGGCCGAGTACGCGGTGCTGGCCAGGACCAGGAACAGGATAGAAATGATGCCGACGGTGACGCCCACGACGCGTGGCATGCGCTT
GGGGTCGCTGTGCTGGCGCTGGATGTCCGGGATCACGATGCCAGCACCGTAGGCGAGCGATAGGTTGCCGAAGCAGCCAGCGACCTGTTCGAAGGAGAGG
TCAGGCGTCGGCACGCTCGGGTGGCCGCTGAGTCCGTGCATGACCACAGCCACGCCGAGGATATCGGCAATGATCGTTCCCAGGCATCCGGCGAAGGCGG
CCCCAGCTCCTTCCTTCAGGGTGGGCACCAAGCACACGGGCAGCACCATGAGCGCCATGAAGATGATCCACGTGGTCTGGCTGAAGGCTCCCGGGAAGAG
GCCATCCAGCAGTGAACCACCGAGCACCAAAAAGACGCACGGGATAAGTAGGCACGAACCCATTTGTGAGATGATACACAGCCAGCGACCAATCGGCCCC
ATGCACCACTGGCCGAGGTCTCCAAATGTCTTGACGGACTTGGGCGCGAGCAGCATGACCTTGGACATGGTAATGGACGCGTAGATGTTGGCGAAGGCCA
TGAAAGCCATGGCAACAACGGCGAGGTAAGGGCCGGCGCGCGAGAAGTTGCCGGGCATACCAAGAGTACCAACGCCGTAGATGCAGCAGAAGAGGTTGAA
GGCCGACTTGGCGTCCTCAGCGGTGAAGAAAGGTCCCTTAGCCATGGTTGTCGGGGCGAAGGCGCGAGGCAAAAAGAACAGGGGCTACGGATCGAGCGCG
CTGCTGATCAGGGGTTGCTTGAGTTGGAGGCAGCCAAATTGAAAATGATGAGGTGG