Description :
From Genome Similarity Track
Location :
Scaffold_60:42745- 50718
Sequence
7973 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGCCATACATC
TCGTCGATGATCCGATCATCGGCTGCAGTGGAATAACACCAGGACGAATTTCCCGGTCCTCATCCTCAGGCACAGGTGGATTCTCAATCAGCATATCGCG
CGGGATCTTCATGTACTCGTTTCCTAGGGAAGGGTTTACATCATGCCTTCCCTCCCCGACTTGCAGCAGGAGCTCGGAGAACGCAGCCATTTCCTCAGCA
GTGTCTACAGTATCAGCTGTGCGCACTCGCATGTTTTCCGTAAGACGGAACGTCTGGAATTGGGGCCACAGCCTAGACGACTTGAGGCAAGCGTCAATTG
TCTCGACGGGTGTTCCATTCTTAACGACCGGGAGAATCTGGCGGAAATCTCCCGAAAGTACAAACACTTTCCCCCCAAAAGGCTCGGTATCGTTGTCAAG
TATGTCCCGCAGTGTTCTGTCTACTGCCTCGAATGCGTGGCGATGGGCCATAGGTGCTTCGTCCCAAATAATTAAACTTGCATGCTTGATCAACTCCTGA
ATATGGGAGTTCTTCCTGATACCGCACGTCGAGCTCTCGTTCAATTTCAAAGGGATCTTGAATGTAGAATGAGCTGTCCTACCACCCATGAGCAAGAGCG
AGGCAATACCGCTAGACGCCACAGCGATGGCGATTTTCCCCGAGAGTCTGACTTTGGCCAGTATGTTTCGAAGCAGTGTAGATTTTCCAGTACCACCCGG
GCCATCGACAAAAAATAGTTTCTTGCCTTCCTCCGGCATTCAACCGCTTCAATAATCTGGTCGTAAACCACCCGCTGACTTTCGTTTAGCTGATCTTCTG
TGCTTACAATTGCCTCCAAAGCTGACGCATCGTATCCAGTGAGCTCACGTCGTAGTAATCCGTTTTGGCGAAGCGCTTCACGAATCAATGTTGGGAACGA
CCCCAACTGAGGAAGCTCGTCGAAGTCAGCTACCGCATACCCACTCGCTTGAAGTAGTTCTTGAATGCTCATCAGCGTTTCAAATTCGACCAACGCCGAC
TTAAAGGGGTCCCTCAAAGCCTGATGTTTGCGTGCGAAGTCTTGGGAAAGATCCGCGAAAAACCGATCCCATAGAACACCAACATTTGCTGGAGCTGAAT
ACACCAGAATGTGACGAAGAGCTGGCGTAGTTGATACGGCATTTGGAACTCAGCCGCTTCCCTCAAACACGAAACCCACTCGTTGTCATTCTCTAAGTAG
CCAGCCTCCCGCGCCGCAATTTGGAATGTTGGGCAGACAATCCCGTTAACCGTTCTCAAGTCTTCAAACGACGTTGGACCTCTACGCTGACAGAGCAGTA
GCCGAAGATAGAACCGCTCCATGTCTCGAGGAGACACATGAATCATGCGACCAACCGCAGCTTGATACTGTTTCCTGCGAACCCACCTTTTCGGATGCCC
GTTTCTCGGCGCTTCCAGCAGACTCTTTGGGATATCCTGATACAGCATCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCGGCAGGTTTTCCAGTGACAGCACTCTTCC
CTTTCTGTCTTGGATAATTCAGCGCCCACTTCGGGAACTTCTTCGTGGTAGGTTCCAGCCCCTTCTCCTCTATTATGAAAGAGACAGCGAGTTAGTTGGA
GTGAGTTTCGTTAATCGGCGTGAGTTCTCAACCAAATCGTAGCCAGCCTTTGATCGCGTGTTAAAGGAGCAGTAGATTCCGGAGCTTGAAGCCAGGGTTG
CCATCCTCAATGAGAGTCGGCAGCCACTTCAGACACAGTGGGCGCGGTTTATGCGTCCTCTGGTCGCGAAGAAGTTATCATGGCAGACGGAAAGACCAAG
TCTTCTGGAGTCCTCCGTGTTGTGTTTGACGCACTTGCCTGCCCAAAGTGGAGGAACCGTTGCGCCTAATGGGTTGTGCTCTGCCCATCATTTTCTCGAT
GTCTAGTAGTGCAACACGATCCCAGATCCGCGAAATATACCAAGACGTCGCTCCGCGCGGCCGTTGCATGTCTGGATCCACAATGTAGATCTGCGCAAAC
TTGGGTGCTACTCGCGCGCCTGTCCGACGGTCTATGTGGGGGAGGAGAGATCCTAGGTAGTGCCCCATAGCCCCTTGAATGCGATATGTGTACACCCCGT
GTGTACCCGCAACGCTCTCGTCTTGATGCACATTTTGAAACGATCGGTTTGAGCACGAAGCACCAATCGATGTAAACGCGAAGGCTTGGTTGTAAGCACG
AATTTGACGGCGGAACTCGGGATCTCCGTACAGCTGAAGCAGCTTCCGTGGCGCGGGGTGCAGTGGAGGCAGATTTACCCTGCCTGCGAGACAGCATGAT
ATCGCAGACTCCCCAGGCCACTTCCAAGCATTGCAGATCGGACAAACTGTTGTAGCCGGGAGCTTGTGTCGCCCGTTGACCACGTGGTCACCTGTTATCA
TGGACGCGTCGAAGTCTTCGAGGGAAATAAGAGCATGTCCATGACGGACACATTGTCGTCTAGTGCGCACCCGCTCGAGCTCGTACTGGCGCTCGTCTTG
TGTCTGCTCAGCTCGTCGATCAGCATGCCGTTGTCGGTCCAGCTCGCGCTCAGCATCTCGTTCTTGTCCCGACAGATCGGCCCGTCGATCGGCGTGCTGG
TGGCGGTTTAGCTCACGTTCAGCGTCCCGGTCTTCTTGTGGTAGCTCTGCTCGGCGAACCGCATGCTGTTGGCGGTTTAGGTCGCGTTCGTATTGTCGCT
GCTGTTCATTTAGCTCCGCCCTGTGTGCTGTTTGCTGCTGCCGATTATTCACTCGTTGTTCGTGAAGATCTTCTCCACGTAACCGAGCTCTTCGGGCACG
CTTGCGCTCTGCGTCCTTTTTCCTCGCACGATCACGCTGAGAGAGTGACATATTAGCTCGTCTTGTGCGAGATCTCTGTGCGTCGCATGTACGGTCGCGA
TCTGTCTGAGACAGTGTCCTGTTAGCTCGTCTTTCGCGAGCTCGTTGCGCAGCTGACACCGGAATCGCTTCTTGAACAGGAGCTGGAGGTATTAAAAGCA
CTGCCAATGAAGCCACCTCGGTAGCTCCCGCTTGATACGCTGCCTCCATCTGGGCCGCAAACCGGCGCTGAAATATAACAGGATCGGACTCTTCCGTCTT
TTCCTCCCGCTCTTCAAAACGGCCAGCTTGACCTTCCGTAACTTCCGTAACCGCAGTTGCTTCTTGGTGCACACTGAGGGCTTGAAGCGCTTTGTTCAAG
TCGCAGCGCTTCCTCCTGCGCTTGTTCATACGTCGCTTCCGTGCTTCCTTCTCCTCTTGCATGGGTGTCGCATTGATCAGTTCATTCTCGCGCAGAGCCT
CCTCAAGTTCTTCCCGCGTCCTTTTCCGCTTAGTTCGAGCCATCAGCCTGCGAACACGAAAACGTGACGCGTTAGACATAGTCTAAGTACACCGCACGTA
GCAGTAGTTTTCATAATGTAGGGTGTGGGGACATCTGCGTACTACCCGGGATTGCTTGCTCCCATCAAGGTTATCTCCGATCACTTATCCCATAGTCACG
GGCCGTCAGGCCCGGAGCGGTTTTAGTTTGCAAATTGTGCAGTCGAATCTTCAGGGTTGGGCCCCTGGATAGTACTGTAGCTTGAGGTGCGATATCCTTT
TGCCAAAAAGGCGGCCGTTAATTGCAAAGGCTGGTTATTGATAGGCTATTACAGCCCCCATCCCATCTGTCGGTTAAAAGGGGCCAGTTACGGTACCCCT
CCTAACCAACTGCACGCACGCAATGTGCGTGCCCATCAATAACCGTTAACGACCGGCTCAACTGGTTCGCTGTCGGGTTTGCGGTCAATGGACCAGGTGC
CAAATGTGCTCTCGCGCAGAGTGGGCGGTAAGATAAAGCCCCAAGAACCCAGAGGGCTCTGGAACTAAATCCCCATAGCACGGCTACCTACTTGCAGGAT
AAAAAATCCCGCAAGTTATAAGCTACCGCCTAGGCAGCCCCAGGAACCTCGGACTATCTGTCTATGTGTGTCTTGCTAGCTACTAATGTAAAGTAACATG
CATACACGCAGCGTACCTCGAGTAACGTGGCGTTCCGCGGCTTCCGTTTCGAAAATGGGGGCAAAATGAAATTTAAACGGTGCTTTTAAGGACGATGTGT
AGACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCTGCACCGGCTTCCTGATACTCAGTCTTTCG
TGACCGCTTCTGCCTCCCATAGCTGGTACTCTAGCCGAAGGGTGCTTTTCCGTGGTTTGGAGCCTCCACGCAGTCGTGTTGTTCCAGCACCCGTGTATCG
GGCTCGTTTGGTGAGGCCCCATCGACCGCGTTATAACGCCATCGTGTAATTGCGATATGGTTTTGCTGTCTATGGTATTGTGCTCGCGGATTGCATCTGC
ATTGCCCATGTTATCGTGCTCTACAACGGCATCGTCCTCCACAATCGTGGTCACCACGAGCCCCCTTCCATTT