Description :
From Genome Similarity Track
Location :
Scaffold_107:42744- 44188
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_107-fgenesh-gene-0.6GMP synthase [glutamine-hydrolyzing]
Pytap_DAOMBR444maker-pag1_scaffold_107-snap-gene-0.52Gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_107-snap-gene-0.53Gene of unknown function

Sequence
1444 bases(100 bases per row)
GGCAAGCAGGGCGTCGTCGTGCTGCTCTGCGTCATCAATCTCTTCAACTACATCGACCGCGGTATCATTCCCGGCTCGCCCGAGAAGTTCCAGAACTTCA
TCACACGCACGCTGCAGATCGACGTGACGCGCCAGAGCTTCTTCCTCGGGCTCCTCGCGTCGGCCTTCATCGCCAGTTACTCGGTCTGCTCCATGGTCTT
CGGCTACTGGGCCACCAAGTTCCGCCCATTCCGCATGATCGCCGTGGGCATGAGCGTCTGGGTCCTCGCTGTCGTGTGCTGTGGCATCGCGCACGCGCTC
GACAGCTACTACTTCCTCATGTTCGGCCGCATCCTCAGTGGCGTaGgTGAGGCCTCGTTCCAGTGCAATGCCACGCCCTTCATCAACATGCACGCGCCTA
AGGAGAACCGGACGCTCTGGATGGGCGTCTACCTCGCGTCCATCACCGTCGGGACGGCCATGGGCTACATCTAcGGCTCCTTCGTCGCGTCTTCGAGCCT
CACGTGGGCTGGTGCGTTCTACATTGAGGGCGCCGTCATGACTGCGCTCATCCTCATCTGCCTGAACTGCATCCCCGAGGAGCTCGACGCCGTGCCCGTG
GATGACACGACAGAGGACGCGCTCGCCTCCACCGGCATGCTCGTGGAGGAGACGTTGTATCACGACGAGCACCAAGACGCCATCGTTGCCGCCAAGCGAC
GTAAGGCGGCGCGGTCACCTCGGCCGCCCAAGGGCTTTTTCCACGGCTGGGGCGAGATCTTTGGCAACATGACGTTCACACTCGTTGTACTGGGCCATGC
CTCCTACACGTTTTCTCTGGCTGCGCTGAGCATCTTCAGTCCCGTGATCCTCATCGGCCTCGGCATGTACCACAAGGAGACTGAGGTCTCGACAGCCTTT
GGCAGCCTCATCGTGTTCACTGGCACCATCGGCACGCCAATCGGCGGTATtCTACTCGACAGGCTCACGAGGAGCGGCTCCGTCTCGAGTGCACAGCGAG
CGTACACGTCTGTGAAGATGATTTTCtACTGCCTCGCGGCTGCTTTCGtGACGGCACTCGTGATGATGGCGTTCACAGCGCAGCGTCTCGCATTCCTGAG
CATCATGGCgCTGTGCTTCATGTTTCTCTGTGCTCTGACGCCTGCTGAGACCGTCGCTGTGATGGAGCTCTTCCCTGAGTCACGCCATGCCATGGCCATT
GCCGCCAACACACTCGTGATCCATGTGTTGGGCGATGTGCCGTCGCCGATCATTTTGGGATGGCTCAAGGACACGTGGGCGCCACGCTGTGGTACGATCG
AGATCGACGGCCACGCAGAACTCAATCCTGACTGTCATCTGGACCACGACGGCCTCAAGAACGTGCTGCTCTTCCCGATTCTGTGGCTCATTTGGGGCGT
TTTGTTGTGGGGTGCGGCAACGATCGTCCTCGGCCGACgCCTcG