Description :
From Genome Similarity Track
Location :
Scaffold_235:42735- 47084
Transcript NameFunction/comments
Hyaar_Emoy2813006Kinesin heavy chain

Sequence
4349 bases(100 bases per row)
TCACACATAGCCCCTCGAGCGGCTGGCGGTAAGGCATTCCCTTACCCCATCAACAGATGTCATCTCTTCCAAATGATTGTTCGTAGCCTGTCCACCTCTT
CTGGAGTGTTCCCATCCGGATCAGGGATCTGTATATCTTTCAACCCAATAGTTTTAGAAGAGGGGTCCACTTCTGGTATGATTGCTCACCCTCAATTTAT
GTCTTCGGCCGACAGGTCTCCATTTTCGAATGTACACACTTGTTCATCGTCTCGTGGCGATTTGTTCGCCTCGGCTTCCTCTTCTTCGACTGCGATCGCT
CCCGGTGGATCGTCTTTGGGGCCACTTCGTACTTGAGGGGTCTCGTCTTGTAGGGGTACCTCTTATTCGCGTGACTGCTCTTTTCTCTCTGGTGACGGCT
GGTGTGACAAATCCATCATTGGGAATGAAGTATTCGACTGCTGCAAAATACGTGGCAGGATATTGTACTGCGGGGTCTCCACGATTGGTTTCTCGTCTTC
CTCCTCGAGGTCAACTTGAAGGTCGACCTGGTCGGTGGTGGCTTTGTAGTCCAGGTTCAGCCATTCAGCGTACCTTTGACAGCCTACCGAGACGAAACCT
TGTGCTCTTGGTATTTGATCCTTCGTCAACTACATACCTATCTTGGTATCATCATGTAATATTAACGTGTGGGGCTAATGTTGGACTTCCTATTCCCCGG
GTCATAGTTGTAACCCATCACTCTCTACCTGTGACCCAAATCCTCCATAGATCTGAGATCGACCTTTTAAGGGGTATCTCCACACATCCACCGGCAAGTA
TACGGGCATATTGTCTCAACTTTACGTCTGCGACTCGATTATTGTAAACTTTCCTTTTTCCGTAGAGTTTTGTCCAGACTCCGTTAAGGAGACAGAGTGT
TCGATCCGCCAGATCTAGCCGTATTCCAGCCGGGACCATGAAATCCATTTCTAAGAGTGCATCCTGATCCACCATAGGGCACACCCACACCTTGAACACA
TACACTAAATTGCAATTTAGGGTGACCTTAATGCGAGTGCGCCCTTCCGTAGAGTATACCGATTCTCCAATGCCAATGCATTCTTGTCGTTCGCTTTCGT
CAATATGGCAACCTACCTTACGAGCAAAGGCAACATCCAAAATGGATATCTCGGCGCCAGTACCGAACAACAAATTTGCGCGATCGTTGTTGACCTTCCC
AGAGGCTTTGGCTCGTTTAAATCACTTAGTCGGAGCGTGAACTTCCAGTCCTCGGGATTTTCCAGGCAATAGGTCTAACTCCATCACTGCACTTTCCCGG
GCGAAATCATTAGGTTCATCGAGAGAGACAACATGGACCATGGGATATTTTCCAATCTTCGATATATTATCGGTCTTCTCAATGGAACCCCCCCTCTCCT
CCTCGGGCTGCTTTTCCACATATGCAAAGATACAAACAATGTGGAACGCTCGACTCGTACCATATTCAAACCTGGTGAGCGTTCTAATTTATCATCTTCT
CTGCTTTCTCGGGCAGCATTCCGGCGTGCTTGGTGGGATTGTACCATTGACGAATCAAGTCGTAGAAGTCCTCCAGCTGGCACTGCCCCGCTTCATGGGT
CGCTCCGCATCCCCGATATACGAACAAGCAGCGATCCGATTGATGTCTCTTCTCTCCGCAGTGGTCACAGGTCATTCTCTTCCAGCATCTCAAGTCTCCA
TGTCCCCTGGACCCGCAATGGGTACATCTCACGTTTGACTCGGCCGACGTATTACGGGTTCCTGGGTCTTCTGCTTGTTTCCGATGTTTGTCGACCTCTC
TTGGGGGCCGGTCCCCCACGGTTCTTGGACTTGGGTCCCTTTCCGCTTTCGCTAGGTAGATCCGTCTCAGGTCTCCCTCGTTATCCGAATTATCCAGGCT
GGATCCCTCCGAACACGACTTTTCTAGGGTCGCTCAGACTGCATGCACAGAAAGGCGGTTTACATCGTTAGGTCGATCCGGATGCTTAGTTACCTTCTGT
CGGAACTTGCTGGAACCATTCAGCGTCGTGCCTTCTTCTTCTGGCGTGCCTTCAATACTTACTCCAATTCTTCCACGTCTGCTAGACGCAGCATTGTTAA
TTGATCTGCAACTCTAGGTCGTCTACGGTCTCGATGTAGTTCTCGACGTGTTCCTCCTGGATCTTGGGTGATCCATTCTTGAGCTTCATCTTCTCCCTGA
ATGCAATCATGTTCAGGTGGTATAGGTAGTCCAACGGGGATTCGTCTGACCTCTTCTTCGCATGGTAGTACTGGCAGGCAACTGGTACCCCCAGACCACA
AAACTCCATCTAGAATTCTTGTAGCAGGTCCTTTCAATTTCCTCGAACGGAACGGCCCAATTGGCGGTACTACTTCTGCGCCGACCCGATCAGAGGTCCT
CCGAATACAATACACTTTTCGCTGTCCGGTGCTTGGTCTCTTGCAAAGGCCGTCTTCACTGTGGTCACCCAACTGCTTGATTGGTCCTCGTCCAGGTCTC
TACCATTAAACGCTTTGAGGTCCGAAGTTGCAGAATCATGATGCGAGGGACCATGTTGAGTCCTTGTCCCATCGTGGCATTGGCCATACTCGCCAGAGTT
TCCTTCAGATCCAGGTCATCCGGGTCGTATTCGCACGAGCCGACCGACTCCATGTCGACGTCCGACATTGTGGGTTGTTTTGGGGCTTGAACCTCTCCAC
TCGGACCATTTCCAGTAGTCGCCAGTCGTGATCCCTGTCTCTCTGCGGTCTCTTATCGGTTAGGGCGTGTTGATGGCGCTTGGCAATCTTGTAGGAACCT
TGCCATCGCCACGTCGAAGTATGCCTGAAGATTACCTACCGGGTCGGTAGGTGCTTCCCCCCCAGCATCTTCTCCACGTGGCGGTGTTAAGGTTTCGGGA
TGATTTGGTCGGTCCGCTATTGGACGAAATTGTAGCCTATCAGGAGTCCTCATTTCCGTTGGCTGTCCACGCGTCGCCCTGTCGTGAGCAGGCTGTTCCG
CCGGCGCACTCGCGCGCAGGCCTGAAGTAACGCGGCACCGGTAGGTTCCAGTGGCATTCGGGCGACGTGGCTGGCCGTTGATGATCCTTGTGACGAGTAC
CCAGCTGAGGCCTGGGCACGCGGAGACTGGGTTTCGCGAGATGGCGGTTCCGTCGACGTGGGTCCGAGGTCACTGCTTGTGTTGGGGAGTAAACCTCGAT
GTCCTGGAGAGTATTTTGACTGTTTCTCTTTGGTTGTACACGTCTGCGGCGGGAGCAAGGTGTGTCTCGTGGGTTTTATCTCGACAAGAATCCCCACACG
CTTGTGTAGTTTTCCGAACGTTGTTTTGATGCTGTCGAACCTCAGGGCAAACACGTCGTTTGGCTCGAACCTCTCCGCGACCATGCCTGCTTCCCGAAAG
AGGGTCACTAGCGTGGTAACTGCGTCTGTGATCTTCCATATATTTGGAAGGGCGACAGTGGTCCGCCGAGCTGTCCAAGCAGCCGGACCTCCAGGGGTGT
CGTCACCGGGTCGCTGGTCAAGAACTTGTCAAGCTTACGTCGGTGGTAGGTCATCGTTATGTCGACGTCAGACCAGGTTAGCGGCCCTGAGCGTTTGCGG
TCGGCTGACTTGGTGTTGGGAATTGATGGCCCGGGACCTACCGACTTGGTATCGCGTGGCGCCTTCATCTTGAACTGTTTCGGCCTGGACGTTGCAATTT
TTTGTTTTTTGTTATTGTTTCGGGGACTTTAGCATCTCGGCTTTCGCCGTATGCTGTTGGTCCTCTGGGGCATGATAGGTATCATGATCCAAGGTGTCCT
CTGCGAGGACATAGGAAGGGTATTTAGGTTTCTCTTCGATAAGTTCAACCTTGACCTTGTTGACCTGGCCCCTCCCAAGAACCGGTCGGTCCTTTAATCC
TTTGTTTTTTCTTCTTTAGTCACTGGCGATCGGTCTTCTAGTGACGCTTCGGTCTTTTCCTCAATTTTGACTTATGCATCTTCTTCCCCTTGGGACTCGC
GGTGAAATACCGCGTCTTCCGAAGATCCGGGCACGCGCACCATTAAGGTGGAGTGCGTTCTCAAAACTGCGTGTTCAGCCCCCAAAACACTCACTGCGCC
GGAATGCCGACTTACGGGGGGGGTACTCCGATTCCGCGTATGGACCTTGACTCTCCTTGTGTACCCGTCGACTGGCGGGTTGCACTTTTCGGTCGACTCG
GACGGAGAGGGAGATGTTTCGGTCTTGATAGAGGTAAACCTGTGCCCCATGTGGATATGCTTCATTCGGTGAGCCGGTAGGTGGCCACTCGATAGACCCA
GTAGAGAGTGGACTTATAACGAAGTTCTTCAGGTAGCTTGTTGCTCCTT