Description :
From Genome Similarity Track
Location :
Scaffold_8:427313- 431514
Sequence
4201 bases(100 bases per row)
CTTCTGGGCTCTAGGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGT
CCTTCTTCGCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGGCCCA
CATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGCTCCTTAAGGCCGGAACG
AGCGCGAAGTCCGACTGGCTCTCGTTGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACTGATC
CTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGAC
CTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGATACGTCAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCA
GGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTATTTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACG
GCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATAGTACATCTTGCTCCAGTTCCCGTAACGGGCGAACAAACCGCAAGGTTGTTCGTCGA
TGGCGTGTTCCGCTATCACGGTCTCCTGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCTGCGTTTTAAAAAACGCTGTTCCCTTTACTGGGA
ACTCGTCTGCAGATGTCCACTGCGGATCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGG
CAGCGCCACGTACGTGGTCGTCGCAGCTTCCAGATGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTGAACGG
CTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGTCCTTTCCTCCCAGGTCTCG
GATGTGAGGCCAGTTTCGCTGCGGAAACAGGTGGAATCCTTTATGGATACCAAGCTGAGCGTTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAGG
ATAAACAAAAAGAGTACTCCGACGAACATTGAAGAGGAAACTTAAGTGTATTTAAAGTGGGGGACTTTGTGTTACTATACACGAGAAACCTACATCTTGA
CACTGTCAGCTCTGTCGGGAGCAACAAGCTGAAGCACCGCTTCATCGAACCATTAGTAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCA
AAGTCAATGACGACGCACCCGACGTTCTATGTTGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGATCCCCCTTGACCCAGCTC
CTCGAAGCGAGGGCCGGTCACCGTCGTCGACGAGGGCGTCGGAGCAGGCACCCAAGTCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGA
GGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCT
CCGGACGTGGCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGC
GACCTCTCGCTCCACCAGGTCCAGGCGGCCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGT
GCAATGTCAAGCACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGTTCCTGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGCGGCTCTCGGGAG
GCGCCGAGTACTCGTACTCGTACGAGGGCATGCTTGACCGGAATGGAGAAGCCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGGCAA
GCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAAGGCTCCTGATTGACTGCCCGCAATCTGGGAACAGAA
GCGGCGGCAGCTTCATAAGTAGTTTGGGGCTTCTTGCCCGAACGGGGTACGGTCGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCG
CGCGCTTCAGGATGTCCCTTGGCAGCATGCGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGACAGCTTCTGATC
TTCATGGAGTTCCCATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAAGAACTCCACGTGGGACAGTTCTCGGGC
ATAACCCAGGGGTATCCCGAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACATGTCGTGAAGTCCTTAAGGGGAATGCGGTGTTGTGCGAG
AAGCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGG
CCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAACCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGG
GTGCCGCCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACAATGGCACC
CTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCCTCATCCGAGGAGCCGAAGAGACTCTGATAGGAGCGTCGAGTCTCCTTCTCCTCGCGGAGTGGAGAC
TTAGAGGCGGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCT
CTTCCTCATCGCCACCGGCTTTTAGAGCGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCACAGAGGTCCTAGGACTGTGATCACCGTGATCACTAGC
GGGCGACTGCACGCTGCCTTCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCCTGAGTGCTCTCGGACTCGGCATCG
TCTTCACTGCCCAATTTGAACTCGCGTTCTACAAACCGAGGGTTCGGACGGTTGTCTGAAGACGAGGGCGACGGACTGCGGCGCCTGCTTGCGCGCTTGT
CCACAGCCGCGTCACCCGAGGAACCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGTGCAGAGCTTTTTGCCGTGAGGCTTAGTGCTCTTGGCCT
GCGCCTTACCGACTGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTAGCAGTGCCGCGAGGCATGTTAACGGTCGAAGTGGAGACCTTGACGAAGAGCGC
ACAGGTTGCTGCTCGAGGCTCTAACTGCGAAGTGAGCCTCCGCCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACG
AACACCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCCCTAAGTGTACCCTGGTTACATGAAGTGTGA
TACTTCACACCTCAGGAGTATGACACGTCATACTCCGAGATATTTGGTACAAGGTACCAAGGTCGTTCAAAGCCAACCATTGGTTAAATGACATTGCATT
TCTATAGGTAACTAACAGTTTGTATTAAACCCAAACTTAATCTACCTATAAATATACTCAGTTTACAATCTACCCTATTTGGGTCACTTCGCTCTCTTTA
ATAAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCAGAAGATAACTTCATCTTGCGCAAGGTGCTGTGTGACCCCGTCACAAGT
A