Description :
From Genome Similarity Track
Location :
contig_28:427170- 429403
Transcript NameFunction/comments
g5651.t1hypothetical protein PHYSODRAFT_535936

Sequence
2233 bases(100 bases per row)
CTCTGCTCGCTCTAGTCGACCTTGATGGACGCGTAGATCTTGCGCGTGAACCACAGCGAGGCACCGACGCCCACGGCGCCCGTCAGCAGCGCCAGCGCGC
CCGAGATGACCGCCATGTAGCCGAAGTACAGCATCGCACCGATGAAGTTCGCCACGTCCAGACGCGTCCAGTAGTAGTACGTCGAGTAGAGGAACACGTA
GCCGCCACAGGCGCCCGACACGAAGAACGACCGCCACCACCTGCGCAAGACAAGTAAAACAAGTCGCCCGTTAGCTACTGCAGCGTAGATAGGTCGATCT
CCTGGCGCACACGTACCAGTTGTAGTCTTCAGCGCAGAGTTGGAAGTAGGTGAGCACGATGGTGATCTCCGCGCACGTGTTGATAAGGATAAGGAAGGCC
AGCAGCAGGAAGCCGAACACGTAGTAGTACTTGTCCGTCCACAGCGACGACAGCACGAAAAAGAGCTCCACGAAGATGGCTCCGAACGGCAGCACGCCGC
CCACGGCCGCTGCCGACATGTGGGTCATGTACCACGGCTGCGGGGGCACCGGGCGCGGGATGTTGCTCGTCGCCACGGGGAACGCAAGAGGCGCTTTCCT
GTAAACGACAAATACAAACGATGTTGTCACCAATCTCCCTCTACGAAAGCGGTTTGCGCATCAAACGCGCGCGTACCTGAAACCGAAGTAGGCGCCCGCA
AACACGAGAGGCACGGAAATGCACGTCCAGAGGAAAAAGACGAGCAGGATGGAGCCGAACGGCACAGCGGCGTCCGAGCCAGCACCCCAGACGAACAGGT
TCAGGAAGAAGAAAAGCGAGAACATGATGCCCGGGAACAGCACAGCCGTGAGCACCGTGCACATCTGCCAGCGCTTGCCCTTGAACATCTTGTACGTGCG
GGCCGACGTGAAACCCGCCAGCATACCCAGCAGCACGAAGCACACCAACAGGGCGATCACCAGCTTACCGCGGTTCGACGGGGCCAAGACACCAACGGCA
GCGAAGAACAGCGTAACGAGCGCCATGCCAAGCAGCTGGCAGCCCGTGCCCACCATGACGCAGAAGAGCATCGGGTTCTTCGACGGCGGGCGGAACACAT
CGGCGTGCACCAGCTTCCAGCCAGACTCTTCACGCTCCTCGGCACGCTCCTCCTCGGTAGGCACGCGGTTGTAGCGGCTGATATCGCGGTGAAGGCTGCG
CATGAGGATCATGCCCACCATTCCACTGAGGAACAGCACGATCACCAGCGCGTTGATGATGGAGAACCAGTGCACCTCGTCGCCGCCCGAGCCCGCGTCA
AAGTACACGTCCCACCGCGTGCGCCAGTCGTGCTCGTTGTCGAGCACCCACTCGACACTGTAGGTCCAGAAGACGGGCATCTTGCCGTCCTTGTTCTTGC
GCACGTACAGCGGGCGCTTGAGCTCGCTCGAGTGTTCGCACGCGTCCATGCGGTTGTTCTCCTCGTCGTAGCTCCTGGCCGCGTACTCGAAGCTGTACGG
GATGACCTTAAAGTCGACGATGCGTCCCTCGTCCTCGGAGCTCTCGGCCGTGCCCAACGGGTTGTTGTTGTAGCCCACGAGGATCTTGACGTGGTTGTTG
AGCTGCGGCACGACCTCCACCTCCGGGTTGAAGCTGCCCAGCGGGAAGCCCACCGTCATGCCGCCTTCCAACGACACGGAGTGGCCGGGAGGTTGTCCAG
GATCCAGTTGACGCGGTACGAGTCCTTGATCTTGTCCTCCCACTGCTTCACCTCCTTGTCCTCATACTCCTGTTTGCACAGCACGGAGCACTCGTGGCCC
TCGAGGAACTTGAGCTCGTACGGGGAGTTCTGGATGCGGTTGGCCGTCAGGTACTCGCCCAAGTTCTCCGACTTGTACTCGATTTTCTCCGGCTGTACAG
ACAGTAAAACACCAACCCTCATTAGAGCAATGTTCCCTAGAATAAGAAACCCTAGTGCGCCCCACCTGACAAAACGGCAGCTTGTAGTAGTCCAAAGGCA
GCAGCGTCTCGCCCGACTTGAGGCTGTTGACGAAGATGGGCAGCGTCTCGCCCTTGGAGTACGTGGTCATCTGCACGCCCGGCAGCGAAAAGCCCTCGCT
GGGGGACGCCAGCGCGGCCACCGCCAGCGCCGCGAGCAGCGACTTGCTCGGTCCACGCATCCTTCCAAGTAGGCTCCAGCTTAGGGCTTGAAAGAGGAAA
ACTGGCCGCCCCTTCCAGCACTATCGGGGCTTC