Description :
From Genome Similarity Track
Location :
scaffold_24:42715- 44268
Transcript NameFunction/comments
Plaha_PHALS_09964Methyltransferase domain

Sequence
1553 bases(100 bases per row)
ACATGCTTACGTACAAGCTCTCAACAAAGAAATTGGTGATCACGCAAATTTCTAATTTAATCTGCGATACTTTACGTGTCGACTAAATATTTGCGATTAC
CGAAGGTTCGGTCAGTGCCGAAGACACTGTGAGGGAAGATTGATTAGCGACGGTAGTAATCCCACTCGACGTTAATGTCCATGCACTTTCGACGGCTGGC
AAAGTCGTTGAAGTGGCATGCACTTCATTTGCAAATATACCACGGTGTCTAGAGCGATCTCCACTTACTGAAAAGTATCTTTGCATCCAAGTTGATTGCA
ATATTTGTGCTGTGTTACCATCTACAGGAGTTCGTACTCCACTTTCAAAATTCCATGTGTCGTCCAGTCTAAATGAATCGGAGACTACCGTGCTTTCATC
GGTTGTATCATTAACTTTGCTACCATTGAAAACTGCCGTTTGTCCATAATCTTCGCAAGGCTCTTCCACATTTTCAAGTCGAAAAGTGCGAAAAGTTGCT
CGGCGAAATCGAGTGCAACTCGAAGTAAACGTTGGGAACATATGAGCAATCGCGCTGTCAATTGTTACCGTGCCGGCTTTGCTGCAGCTTCTGACTCGTA
AATCAGCATTAGAATCGAGATTCCGAAACAAACGTTGGAGATCGCCTATGTACGGAGCGGCAAGTACAACTTTTTGCTGTGTCTGGATTGAGCTCTCCAG
TGTACACAAAGCTTTTGCCTTTATATCATTTGTACTCCCAGCATCTTCTTTTTCGGACATGGACAACCGCCGAGTGCAAACCAAATCAGTCACGCGTAAT
TCACCACCGACCTTCAAAAGACTGAATGCCGTCTTCAAAAAGTCATGTTTGTCCGAAAGAAAGTTCGACGATCGGATTGAACAATTACAATGGACAATAT
CAATGTGACCACGTAAAGTTAAAAGTTCATGACCTAGTAAAGTCAATGCAGACTGGGAGTCTACATTACTGTAATCTCCCACAATAAATTTCATATTCAC
TGAAGATAGTCCCAGTGTGCGAAGACAGAAACTTCTAGCTATCCTTTCTGCAGCGAAAACATTTGAGGAACTAGTTTCAATGCATGTCACAAATCCATTT
GCACCAACTGCCTGAGCCAGAAgaaatgcatcagcaacactACCAAGTCCCACGACAGCCACATGTAACCCTTCAATCGCACCAACAAAGTCATCAAATT
CCTGACATACACAGCCTAAGTCACGAATGCTTTTTGGAATTTGATTATAAAAAGCCAATGTTTTGGACGATGCTTTCATCCGCCCTTTTTCAAACCACTG
CGCAGAACACAATGTCATTGGAGCTTCATTCATTGAAGACGCCGATTCAATCGTCAAAGTGTTTTGCGGTTGACTAGATGATGACAAAAGTCCTTCATGA
TCGCTAATTCCCACATGGTGGCGAGGTGCAAGCTGCTCAAAATCAGCCTGTGAGGCTGGTGATAGCCCATCGTTCCAATCAGAGATCGATTCACACACGG
TACTCGTCACCGTAGTTTTATTCGCTGCTCGCGTAGATTTCCGTAAACGAATA