Description :
From Genome Similarity Track
Location :
Scaffold_75:42702- 44766
Sequence
2064 bases(100 bases per row)
TTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGG
GGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCG
TGGATCTAGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTGTTGTCCTTTAAGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTG
AGAACCTCTAGGGTGTAACCGACCAAGTAGTAAATTCGGTTAACCTGTCGGATCTGCACGAGTAAAGGAAAAGCTCACTAGGTTGTAGGATCTGGCCAAT
GTATTATCCAGTTATCACTACCAACACTAGATTCGCAATTCCCAACCTTCTCGGAGCTCGTACGGCCAATGTAGTTCCGGTCTGAGGGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC
CCAGCCGGTCTGTGTTCTAGTGCGAGTACCGTTAAATGACAATGGTTGACATCGGAACTCAGGCCCATGGTGGATTTGAACCCACGCGAAATGAGTCGTT
GGAGAGTAAGATGGGCGATCCGGTAGGACGGGTAGGTTCACTGGACGACGCGAGAGGTCGGCGAAGCGAGTAAAGACGCCAAAACAGGCAAGCCAGTGGC
AAAAGAAAGAAGAAGTTGGCCAATGTGGGATTCGAACCCACGCCCTTTCGGACTAGTGCCTTAAACTGGCGCCTTAGACCGCTCGGCCAATTGACCACCT
TACGCAATTACAAACACTCGCGGCACTCGAGAAAAGCACAATACGCCATTCGCCAACACTTCACAGCTCACAAGCCGCGCGCCGCACGCAGCCAAACGAA
CCATGCAGCACTTTACCTGTCTTGGACGACTCGCCTCCGCCACCGCTTGCCTCACTCCGTCTTCACCCACCCAAGACTTGACTGATCTGATGTCGTCCAT
TTCCATGAGCCTGCCAAACGCTGTGTTGGCCTGTCACACGGTCGCACTTCCTCCTCATGCTCACATACGTCTACCCTATTCGGGAAAGTACTGCTTCGTT
TTATTACGTCTGGTGTTTTGGCCATTCGGAGCGCGTGCCAACGAACAGGAGCCAGCTTCGATGCTCGGTCTCGGCACTGTCCAAACCACGCGAGCAAGCG
CCCTTACAGTAATAAGGCGTTGACAGGGTGTCACAGCATAGTCCTATTAACCCAGCACGGTCTGTGTTCTAGTGCGAGTACCGTTAAATGACAAAGGTTG
ACATCGGAACTCAGGCCCATGGTGGATTTGAACCCACGCGAAATGAGTCGTTGGAGAGTAAGATGGGCGATCCGGTAGGACGGGTAGGTTCACTGGACGA
CGCGAGAGGTCGGCGAAGCGAGTAAAGACGCCAAAACAGGCAAGCCAGTGGCAAAAGAAAGAAGAAGTTGGCCAATGTGGGATTCGAACCCACGCCCTTT
CGGACCAGTGCCTTAAACTGGCGCCTTAGACCGCTCGGCCAATTGACCACCTTACGCAAACCACAACCCTCGCGCAAACAAAAAACGCCATTCGCCAACA
CACCACAGCTCACAAGCCACGCGCCGCACGCAGCCAAACGAACCATGCAGCACACCACCTGTCTTGGACGACTCGCCTCCGCCACCGCTTGCCTCACTCC
GTCTTCACCCACCCAAGACTTGACTGATCTGATGTCGTCCATTTCCATGAGCCTGCCAAACGCT