Description :
From Genome Similarity Track
Location :
Scaffold_227:427- 4480
Transcript NameFunction/comments
Phyke_g6896beta-catenin-like protein
Phyke_g6897hypothetical protein PHYSODRAFT_521896

Sequence
4053 bases(100 bases per row)
AAACACGCAGACGAGCCAGCTAAATTCCTggagtcggagctggcgctggacCAAGAGCTCACGCGCTGGAAGCAGGTCGCAGCCAAGCCCGAGCTATTTC
CAGTCacgatggagctggaggtgccTCGAATGCTGCTGGGTCTCTTCGCCCATGAAAATCTGGACATCCGATTGGGTGTTTTGTCCTTATTAGCAGAGCT
GACGgacgtggatgaagctgcgaCGTCTCTGGAGCCCACGAGATTCTTAGCCAAGCACCTtgtggacgagaagctgctgcccTTATTAGTCACCAATTTA
TATCAGTTGGCAGTTGCTGTCAAGACTGAAcaggagcaagaagaagaggttaCGGGAATTTACAACTCGCTCCAAATTCTCGAGAATTTAGCGGATTTAG
AGCCCCAAATGTGTGCTCAGGTGACGGAGACCACGTCTATATTGCCGTTTTTGTTGACACAAGTGGCACCTACACGAGCATTTAGTGAGAACAAACTGTA
TGCAAGTGAGATTCTGTCAatcttgctgcagtctggagCTGGACCAAGAGAGAAGTTCGTGGCGTGGTTGGGCAAGCCACGACCTAGTGAAGAGCCGAGC
GTGgcgaagagcaagaaggatAATGATAAGAAGATCGATCTTatggacgagttgctgcaggcATTGGCACCGTATCGGAAGAAAGATCCCAATaacgacg
aggaagaggaactggTGGCCAACTTGGTAAATTCTCTGTGCAGCGTCTTGCTCGTACCGGAGGCGCAAAAGCAATTTCGCCGGCTGGAAGGGCTGGAGCT
TCTACTGCGCTGCATGAAGGATCGTCACAGGCTTGTGTTTGGTGGTGCGTTACGTGCTCTTGACCACGCACTCATGGGCAATACGAGCAATTGCGAGCGC
TTGATAGAGATTGGTGGCCTACGCACTGTTTTCTCTGTATTCATGGGCAGGCACGGCAAATACAAGTCGAGCAGTAGCACGAAGACGGGCAAGGCTGCCG
AGCGTACTaaggaagaagagaatgCGGCCAGTCTGGTGACTTCAATGTGCGCGTGGGTGCGTGCAGACGCTCCGGCGGATGGGTATGATCGCCTGCACGC
TAAGTTTGTGGAGAGTGATATGGAGAAGGTTGACCGGCTGGTAGATTTATTCGTTAAGTACCATGAGCGCGTCGAGCGCAGCTCTCATttggacgaggag
gacgaagaggaagaggacgaagacagTCGGTATCTACGACGCCTTGATGTCGGTTTGTTCGTGCTGGAGCGTGTTGCTTTCGTGGTCGCACATTTGTGTC
GTTTCTCTAAGAAGTTACATGCCTACATTATGGTTAAATTCCACGAGCGGAATGTCGAGAGTGAAAGTCTCACAATTATCCTGCGCGAGCAGTTAAATCT
CCTCATCGCTGACGAAACTAGTATGAAGAAGGGAGGCGACGGTGCGATCACAAAGGATGTCGTGAACGACGAAGCCAAAGAGGCAcagaagacgcagctt
cGACAATTACTAGAGACGCTTGAGGCTGAAGAGACTCCACTTAAGCAGAATACAAATGAAAATGGCGACAAGGAGACAGTGAACGGCAACAAGTCAGACA
ACGAAAagccagcaacagcatcgaaATGAATAAACTCAACGAGGTGGCTATTTCACTTTATTGGTGCCGAAATATCTGAAGATTATCATGGAGGTTAAGG
TCGTCGTACAACTTATGGATGGATTTAGCTGGACGTGAGCATTGGTGCGATGCAGTTCCGGTCAAACGCATATGGACAATAATTTCCCGTTTATTTGTTT
CAGGGTGTGAGAAGCTCGGCCGCTCACGTGGTCTGTGACACGGCAGCAGGAATGACTAGGGTTACCTCCGGCGACGAAGACATAGCTTCATCACTACTTA
CTTTGAGCATCATgtgcttctcttcgtcgttATACAGTGCTGACAAAGGCGTGGGCACATCTGCGATGGCTGGTGCCGAATCTGGCGCTGTGGACTTCGA
AGTCAATACGGTGACGCATGGTCCTGATTGAGGGTTTTGAGAGTCAGTGGAGTCTAGTGTCGGCGTCAACTTATCATCTGCATCTTCGGAACTAAATGCT
TCTTGTGTCGGCGAGGTTTCTGATTTGCTTGATGGGATGCCAAGTTGGTTAGATTGTGTTGCATTATCTTGAGGTTCGTCTTGAGCTGGATTCtggtctc
cttctccatagAGCATTGTTGCAAATGTTGGTGAAGGACCCGACTCGACTACCTGCGGAGGTTGGTACTGCTCCTCCCACAGCGTTTGAGTTGGTAACAG
CACAGCAAGACGAAATACTTTCCAGCGTTCAAATGCTGAGTCCCCCATAAAAAGCTGTGATGAATGCGCGAAAGCACTTGTGAGTGCTTGGTCCAGCGAG
ATAGCCACATCCAGAAACGCAGCTGGAGGGgccatcttcttggcttcagAAGTATTTGGGGGTTCACAGTCTCCAGAAGATTTTTCGTCTGTCTGGGGCA
GAGTAGACCAACCGAAACATTGCAGCAAGTAATCAAGAGCTCCACCCAACAGCAAGTGGAGTCGCAACATATCTGTGGGAGAGCGAAATGCTGGCAGCTC
CTTGCCAAACATGTACGGGGAATCCTCAAGCGTCACGATAAATAACCGCGCGATAGCGCAGTGCAGAATCGAAGCTTTCGGAAAGCGTATCACAAGCTCG
AGTAGTGCGTCAAGTGCCCGAGCACGGATCACGGCAGTGTCAGCCACGGTGCATGATACGTTGAGCACGGGTAACATGAGATATACCAACTGAACATGCG
TGGGCTTAAACCGCCATTGTAATGAAGTCCCCTCTACAGAAGATGCGACCAAGTACGACAGCAGCGTGGGTAGATGTTTCAAAAATAAATGCCAAATTGT
TGGCAAGTCCTCGTGTGGGCTTCCCAGTGCACAAGAAATCAACGGGTCTTCGCGTTCTCCGCATTGAGTTTGTCCACTTGGCTCTTGAGCTGCGGTGATA
GCTCGACAAAATGCTGCTTTGGCCACACATCCACACTGCGCCTGCTGCAATAACGAGTTGAGGACTTTCAGCGCGTACGATTCGTTTGCAAACGACGTGG
GTAGCGTTTCCAGGTCAtccgtagctgctgcaatcaGTTGTTTCCCACTCTGCTCGGACTCACTAAGTGATGAAACCATAGCAAACCCCAAACTACCTTC
GCGCCGCTCGTGAATTAAATCTGTAACCAGGTCGCACGTGAATACCATCCGTGAAAATCTCACTGTCTCAGGATCGTTCACGACTCGTTGGCGAAGCCTC
TCAGATACGCGTCCACGTACTTCCAGTGCAGGATTGATTGGTGAGAGCTGTAATAACGCAAGTCCTGCTAGCGTGTCCACCTCAAACTCAAACTCCTTGT
CATGCAGCTCGTTAAACAAACGTACCAATACATCACGCAGCGGTTCATAGaaaatcagcaccaacagcgacTCCAGAAACGCATTCTGCTGTCGAGAGCT
TTTGTCAAAGAGTGCCATGACCATCTGTGGAGAGTATTGGTCCATGAAAGCCGTAAGGAACCGCGAGAGTGCTTCAAGTGTCATACTGTCCCGCGAATCA
AATTCAACCAGCGAGCGAGCGATTGTTGTTCGAGCTTCTCCTTTCAGTGCACTCAAACCTGCTAGGAGTTGATGTGAAAATCCTGAGCGGCACAAAATCC
AATGTGCACGAAATCCTATTGCGTATTCTTCGTAAGTCGGGAGGTTACCCGGttctcgtgctgctgcagccgtcaCCTTTGCAGTCAACGTGGGCTCTTT
AAGCATGGATCGGATCAGACAGATTACTGGATTAATTAAACAAGACAAGCAGCGTAAGTTAACGGATTCTGGTCTTTCAGATGATACAAAAAATGACCTA
CAATTTTCTGGCGCCAGGAGGAATTGAAGCACGGGTATGTACTCGTCCGAGCGCACAGTGACATCACTCAACACAGTTACCAAGTCATCTTGTTGTAGTG
CATCTACGACACTGCGGAGCGCTAATATCTCCATCAAGCGCTCGTTCATCGCG