Description :
From Genome Similarity Track
Location :
scaffold_1746:427- 2918
Transcript NameFunction/comments
Pl_100376NA

Sequence
2491 bases(100 bases per row)
CACGCGGCTTCCCAGGCGGGGAAACTGGGTACGCTTGAGTCCCTTCGTCACGATGTGGATAACCTGGGACGCGAGACCCGGGAGCCTCATGGTCGCGTTG
ACCATCGAGCCCCCGGCTTCCGTTGTGAAGGACTTGCGTCGTGACCTCGACTACTTGAGTCAGGAGCTCCACAACCGGGCTTCTTCTGGGGAGCCTCAAG
GGTATGGGTATCACCCAACCTATACGTACGGCTCCTTTGGAGGCCCTTCGCATGGGCGCCTGCGTAGTCGGCGTACGAGCCGCGGGGTATCAATCTCCTT
TCTCCATGCAGACTTCGGCGACAACAGTGCCAGTTGCTTCCCGCTCCACCTCGGTTTGAAGAGGTGAGCTCAACTCCTCGCGGATGGCCTTTGCCTCTTA
TTGAGGAGAAGGGCATGATACCGCTTACGCCTGCCCACGTAGAACGTTGGGTGGGGTGCCATAGACTTTGGCAAGTCTATTGCGTAGGCAGCCCCATGCA
TGCCGTGGACCGCGAAGGGTCCGGTGAAGCGGTGCTTCAGCTTGTTGCTCCCTACAAACCTAACCAGCTTTAGTGGTAGATTTTTAGTATCTAGGAACAC
TAACTCGCTAGTGTTAAACACGTTAAAGCTTCCCTACTTTGTTTGTCAGAGTACGCTTTGTTTGTCTTGGGCTATCGCCATTGCATCTCTAGCACGGCTG
ATAAACGTCAGTCTATTGTCAACAAAAGTTGACAGATGTCGTTTCAACGACCCATGGCCCACTTCAGAAACTAAGGAGGAAAAAGATTTCCGAGCCCCTC
CCCTACTTACGATGGAAGCATCACTGCCTCCTCGTATGATTAGCGGTACCTGAGGAAGTCGCAGCCCATTCAAGAAGATCGGGGTGGACCTGTCGATGCG
TGTACCGCATTACTGAGTGTGAACTCAACCATAGGCAGCTGGACCAACCAGAACTGAGGTGACTCTGCACAGACACTGCGAAGCGTGTCGTCAAGAACGC
GATTCACGCGTTCCGTCTGGCCATCCGTTTGAGGATGGTCTGCAGTTAACACTGTCAACTTCGTTCCAAGGAGTTGGAACAGGGTGTTCCAGAATGCTCC
AGTGATCCGCGTATCTCGATCCGAGATTACGGTCTCTGGAAGACCGTGATGGGGGAACACGCAATCCAGGAAGAGCTGTGTGGCTTGCTTCCCTGTGACT
TTGTCACGTACCAGAGCAAGATGAACCATCTTACTCAGACGGCACACAAATACCAGAATGCCGGTATTGCCCTTGCCATCGGCTAGGAGGCCGAAGACAA
GGTCGAGACTCATCGACTTTTATCAAAATGCTGGAACGGGGAAGATCTGGAGTGGAGCCGAGGTGTTGCCTGTTAGCTTCACCTGCTGACATGTTTCACA
TGTCTTAACGTACTGTTCAACCCACTTGTGCATTCTGGGCCATCAAAAAGTCTGAGAGACCAACTGGTAGGTCTTCTCTCCGCCAATGGCCACTAGACCG
CGCGTCATGTGCCTCAAGAAGTGTGTCGTACTTCAGATCCTCGCCGTTCGGAAAAACGACACGAGGAGGAACTCCGGGCTCTACGCGATAGTAGAGTAGG
TCATCGGTCAGCTCATATCGACGGAGCTGTGACTGCTGTCGAAGTGATAGCCTATTGACGGTGGCATCCTTTCCATTCGAAAAAAAAACGCACTAAGTGT
GTGAAGTTCTTGTCCTCTTGATACGCCAAGCGTATCCGATCGTACAGATCATTCGTGATCCGACTGATATGAGCTAGTTCATAGTCGGGTCGACGCGATA
GAGCGTCGGCAAGCACGTTGACCTTGCCCGGCATGTATTCGACGCGGAAGTTGTATTCCGCGAAAACGGACAGCCACCTCGCCATCCGTTGTGATAGGTG
TGGCGAGGTGGTAGCAGTCCGCAAGGACAAGTGATCAGTGTAGAGCACAAAGGGTCTTGAATCCAGGAGGTGTACTCAGAACTTGACGAGAGCATACTTC
ATTGCAACTAGCTCCTTGTCATGAACGGGGTAGTTCCGTTCGGCAGCTTTTAGTTGCCTGGACTGGAACGAGATGACTCGTTCTCGTCCTTCATCGTCGG
TTTGCAACAGTGCACAGCCGATTGCATAGTCGGAAGCGTCACAGACGACGCTGAACGACTTCTTCTCGTCCAGCAAAGCCAAAATTGGCGCCTGTTGCAG
GTTTGCCTTGATGCTGTCGAAAGCATCCTGATGCCGTTGCTCCCAAACCCAGTCGGCATCTTTATTTAAATGATCTTACAGAGGTCGAGTAAGGGCAGCG
TAGCCTGCACTATACTTATGGAGGTAGTTGGCTAGGCCCGGCTACTTCCTAAGGTCTTTCTGAGACCTCGGTGTCGGCCATGCCGCTATGGCCTTGACCT
TCTCCGGATCGGCACGTACACTGACCCTATTGACAAAGCAGTCAAGGACCTTTATCTCGTCAGCCGCAAAGACACACTTGTCAATGTTGGC