Description :
From Genome Similarity Track
Location :
Scaffold_2375:427- 2407
Sequence
1980 bases(100 bases per row)
AGATAACGTCGGACATGCGGATGACCTCTTCCCGCAGAGCAAGACGACGGATGGACGGTCTGCTTATTCCTTGAATATTATCCCCGTAGGATGTAGCGGT
GGCGCTTCGCGCCTCCCTTGCCCAGCCCCTTCACACCTTTGCCGTGGCCCAgtatcgctgctgcatgcaATCAGCTGATCACACCGGAGGTTGTTATACA
TGCTCAAATACACGAAATTATTATAGCAATCGCCTAACGTACCACACGCCCTCGCCTCTGTCCTTGAGGGCAAAAGCCAAAATGCCGCTCATCTGCCTTC
GAAACATGTAGAATAAAATACCCCCCATGTAGGCAATGATGATGCCCACCGAAGACTACTTACCAAGACACTTCGTGTACGGCGTTTTGAAATACCCACC
AATCCAATTACTTTCGAAACGAAATGGTCGCTAACATCGTTACAACAGCCAGCTTGTATTATGCCCATGCTGCGTTTAGACTCACTTCAAACTTGTTAAA
CGCCCTAAAACAACATTGTATCTCTGGTCTGCCTCATAGCGGTCCAGTGCACACTGCCGCTGCCAATGTTCCCTCTCTTCGCGTTCCCTGTTGTGTGCTT
TCTCCCACTCCGCGCAATTGTGCTGATCACACTATTGGAACCACATGAACAGCTTGATGAGATCAGAATACGAGTTCTTACGATcgcatggtgctgctgg
tgataCGCGGGAAACGGAGGTAGGCAGTAGCGAATGATCGTGTGAATCTGGAAGACATCCGCTGTCTATGGCTGCACCAAACGAAGCGTTGCCACGAGTG
CTGTTGTGCGTAGCTGGGAAAATAGGCGTCGATGAGAGCCCATCAACTTTCGAAGACTCCCGTGGCTTGATCGGTAATGTCCACCGTTGTGATTCCGCTG
CCCCTGTATCTGGTCCTATGCGGTTCGCTTCAACTGCACCACGGGGATCATAGCACTCTGCATCGCGCCGAACCGATTCTGATTAGCGCGATCCCACAGG
AACTCGTGTAAGCGTGCCCCAAAGTTGAGATCAGCCTCGTCAACCCAACTGGGCTCTGTATACACCTTCCAATGCACTAGGAATTCCCGGTAGGTCCTAC
CATATCGCATTCTCCAATCCTTCCCCATATCGGTGACACTTTCCACTTGGTACTCTTTCCCATTCAAATCTGAGGCCCAACTGTCCTCTGGCAGGAGGAT
CTCGTCAAAGTCCAGCCGATCAGCCTCCGGTACGGTTAGCTCGGCCTGCGGTTAATCTGGGAACTCCCGGACCGGCTTCAGGTTGGACACATGCACGATC
AGGAAGAGGCGGTACTCCGTTCTGGAGATCTAGAGTCGCATGGAAAACGGGTTCTCTGCGACGCGGAAAGGTCCGTGCCACAGATGTGCCAGCTTACGTG
CGTATCCCTCTTTCACCCGATCCAAGTACAGCCAGACTTGTAATCCGGCCTCGATCCGATGCGGATCGACGTCAGCATTGTGCAGATCGGCCCGATCTGC
GAtcgccttgcgcagcttATCGTTGACCTTCGCCTGGATGTAATAGCGCTGGATCTGGTATCTCCACCTCCTAGGATTCCGATCTCGCGTCCGCATACTA
CCCAGTGGCACAGTTGCTTCCCACTTCGATCTCGGATCACAGCCATGTACCAAGTAGAAAGGCGTATCTCGCGGATCCGATCCTGAGCCGTGTTGATAGC
GAACGTCAGTCTCTCGGCATACTCGTCCCAATCTCGCTGATCCAGATCATGTACATACATATTCAatgcgcgcgtcgtcgtcggcaccATTCATTCGGCC
GTTCTGTTCGCTTGTGGCCGATAAGTCATCGTCACCCGCTGACGTTGACCGAGGATCTTATAAATGGCACGGAAACAGTTGGACATGAGCCCTGGCTCCC
GGTCGTGTCGGATCGCCTCGCTAGCTCCAAATCTCTGGAAGACGCATTCTTCGTACGATTCGGCGATCGTCTGAGCTGTT