Description :
From Genome Similarity Track
Location :
Scaffold_19:42692- 46258
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_19-fgenesh-gene-0.7Septum-promoting GTP-binding protein 1
Pytiw_DAOMBR242034maker-piw_contig_19-fgenesh-gene-0.8Gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_19-fgenesh-gene-0.15Pc22g23250 protein

Sequence
3566 bases(100 bases per row)
CTCCTTCATATCGTCACGGTGTGTACTACCTGCTGACGTGTGTGTTTGCTCGTTTAGCCTCATGGTCAAATACGTCGAGGGCAAGTTCGACGAGGACTAC
ATCCACACGCTCGGTACGAACATACACTGCTTTGTATTGCGAAGGTTTTTTGTGCCTATTGTTGGAACTGAAGGTGACGCAATGCAGGCGTGAACTTCAT
GGAGAAGACGATCGCGCTGCGCAACACCGAGATCACATTCAGCATCTGGGACCTGGGCGGTAAGTACCTGATGCAGCCGTGGTTCATGACGAAGAGCTAC
GGAGCGTTTCTGATTATTGACGTGTTGGCTTTGTTTGCTAGGCCACCGCGAGTTCATCAGCATGCTGCCGCTCGTGTGCAACGACGCGGTCGCGATCCTC
TTCATGTTCGATCTGTCGCGGAAAGCAACGCTCACGAGCGTCAAGGAGTGGTATCGTCAAGTGCGCTCGATCAACAAGGTGCGTACACCACTTGCCAGCG
GTGTGTGCGATAAGCCTGATCTAATGTCGCTCTGTGATAAACTTATGACAGAATGCGTTCCCGTTTCTGATCGGCATGAAGTACGACCACTTTACGAACT
TCTCCGCGGAAGAGCAGGAGGACATCACCAAGCAGGTAGGGGTAGAGCCTGGTTGCCTATATAAATTCCAGCATTAACACACGACTTTATGAACATACGT
GTGCAGGCGCGCAAGTTCGCCAAGGCCATGAAAGCGCCGCTCATCTTCACGTCGGCGTCGCACTCGATCAACGTCCAGAAGCTCTTCAAGGTCGTGCTCA
GCAAAGTGTTCGACCTCAAGTGCACAGTCCCGATGATCGAGCGCATCGGCGACCCGATCCTGCAATATTAGCAAGCAGTCAGCAGCCAGCAACTCCAGCT
GCTTTACTGGAATGCGGTACGAGTTGCGCTGCGTTTTGTGGTCTAAAGAATTAATAAATCGTTGTTTCTGATAGGTTTGTACCCAGTCTGTTCGCCCTCT
GAAGATCTGAACCCATGTTGCACTTTCTCACATTGAAAAAGTACATGTCGGCACACAAACGGAGCACTAGGACACGCAAGCTCTGCTGGCACTGAGCTCC
AGTCCGAGGCCGAGCTGCTCGCCTTTTCTCTGCAAGCGAACTAGACGAAGACGGTCCTTCACCATCCCAGTCTCCACCAATGCTGCGACTGGGTTTCGAC
CCAGTGCCGCTCGCCCACGAGCTCGTCGCGACGGTCCGCGCGGACCTCTATGAGGTCTTCATTGACAACTGCGTAGTCGAGTTCGTCGCCAACGCCGTGG
TGGTGCTCGCCATCTCGGCGTACGAGGCTGTGTGGCTGTCGATTGACTGCCTCAGCGGCGCGACCACGGTCACCAAGCCGCCGACCTGCTGTTCAGTAGA
AGCTCCCACCGACCAGTCTGTCCAAGTCACTGACAACAAGAAGAACCAGACGCACGACAAACTGCAAGCCACCGAAGCCGCTCAAGCGCATCAAGGTCAC
GAGGACCTACCAGCCGCTGAAGAGCTCCCACGCACTGCTGACTATGCGTATGAGACGTTCAACGTCTCGTTCACGCTCAAGCTCCACATGCAGTGCGATA
AGATGGCGTGCATCTTCACCAGCAACGACGAGCGCGCGGCTGTCAGCGCAATTCTAAGCGCCGTGCACGGCCTCAACGCGCGCCTGTGTTTCCGCAAGTG
GCTTGTGCCGTACACGCGCATGCTGCTCCAGCGCTGTGACGGTGACGAAGCACGCGCGTTTGCACACATTGCGGGCAACCCGCACCTCTTCGATGGCTTG
CAGGCCAAGACCGAGCAGGAGACGTGGTGCTGGACCAGGCACTGCTGCGGTTGCAACAAGCCGCGGCACAAGTTCGACGTCCACGACGACGAGATCCGTG
GCATGTTCACGTACATCTAGAGACACAAAGTCGATATAGTTGACTAATGCGTTTGATATCTTCTGTTACCTTCTAATAACGTTTGGCATAAAGACGCCGT
GAGCTTTCCTACTTATCACACTTACTGGATGCCCGCGTACTCGGCCATGCCGAGCGCCACGTTGATGTTCTGCACAGCCTGGGTGGCCGCGCCCTTGAGT
AAATTATCGATCGTGACCACGACCACGAGGCGACCCGTGGCTGGGTCGATCTGAAAGCCGCCCACGGTCGCGTGGTGCGCGTGGGCGTTGTCCTTGACGT
ACGGGATCGCCGACGTCACGTTCACAAGCGCCTCGTGGGTGTAGAACTCCTGGTAGAGCTCCTCGATGCGCGCGTCCGTGAGCGTCGCGTCCTTGAGCTG
CGCCGAGAGCGTGAGGTGGATGCCCTGGAAGAACGGCGCCACGTGCGGCATGAACCGCACGGGCGTGCCCAGCTGGTGGCTTACTTCGTGCTCGTGGATG
TGGTTCACCGACTTGTACGCCATGATGTTGTCCGCGAGCATCTTGGGGTTGTTGGCATTCGAAAGGCCCGTGCCGGCGCCGCTGTACCCTGATACGCCAA
ACACATGCGGCGGGATGCTCGTGTCGATCAAACTCTCGCTGATCTCCGGCTTGCCGCCGAGCAGTGGCAGCAAGCCCAGCTGCGTGCCAGTCGCGTAGCA
GCCTGGGTTGGCGATGTGCGTGGCGCTTTCCAGTCGCGCACGGCCGCCGGGGGCCTCGGGGAGGCCGTAAACCCAGTTGGCGTTGAAGCGCTGGTCCGCG
CTCAGGTCGATGATGATCTTGTCCTTGCGCTTGAGCGCGTCCAGCACCGTCGCGTACTTCTCGCAGTGGCCGTTCGGGAGCGCGAGGATCCACACGTCCA
CGCTGTCGGCAAAGGGCGAGTGCGGGATCTGGTCGAGCCCCAGGTCGCAGAACTCGAGCTCGTCCGAGATGTTGAGGCGCGTCGAACTGCTACCACCGAT
TGGCGCGGCTGGCAGGTTCGTGTGTGGGTTGAGTGGTGGCGCATTCGCGAGTTCGACGACCTTCTGGCCCACGAGCGCGCGCGAGCTGGCGCAGACCAGT
TCGAGCTCTGGATGCTGGCCGATCAGGCGCAGCACTTCGCGGCCGACGTACCCACGCGCACCAAGCAGTCCGACGCGGCGCTTCGTTGGCGTGTGGGCGA
TGCCGGCACTCGCGTTGGTCGTTTGCTGTGGCTTGTCGCCGCGGATGCACACTGTACCCGTGCTGCAGCTGCTGAGGATCTCGCGCGAGAGCGCAGAGGC
GGACGTGAGCGCCACCGACGAGGAGGACGGGAGGCCCTGCAGCAGCGCATTGATCTCGTTCAGCTTGAGCAGCGTACCCTGGCGACCAGTGTAGTCTCGC
GCCGCCATGCTCTCGTACTGCTTGGACATGTCGATCTCCTTGAGCTTCGTGCCGTCGTCTTCGATCCAGCCGCCCTTCGCGTTGATGAAGATCGTCTTGT
ACGGCTGGACGCTGAGCGCGAGCTCGCGGGCGGCGACGTCGGCGTTGATGTTGAGCGTCTGGCCGTCCGCGCTTTCGCCCAGGCACGAGAGCACTGGGAT
CTGGCCGTTCGCGATCGCCGATTCGACGCCCTCGCTATAGATCTGCGAGACCTCGCCCACGTAGCC