Description :
From Genome Similarity Track
Location :
scaffold_783:4268- 12678
Transcript NameFunction/comments
g10257.t1hypothetical protein
g10258.t1 hypothetical protein PHYSODRAFT_337674
g10259.t1hypothetical protein
g10260.t1 hypothetical protein PHYSODRAFT_534315
g10261.t1 hypothetical protein PHYSODRAFT_325775

Sequence
8410 bases(100 bases per row)
TTCCAGCAGTGGACGCGTCCCAAATACTGGCTGTTCTCGCGGAGTACGCGGGCTCCCAGCGCAGCCAATTGGTTCCCGGAGTTGATCACTGAGGCTAACG
TCCGTGCACTGTACGCCGCTAGTCCTCCGCCCTGGAATGATCTGCGCACACTTGTAGCGCCAAGATCTTTCGAATTAACGGGTTGGTTCGCCGACTTCGT
CCGACTATACTCTGACTTCGAGGACGCACACCTCCAAGTGTTCTGGGAGACTACCCACAAGCTTCCAATCAGCGACGCCATGAAGTCGGCGACTCCGTTC
TTGGCTCAGCACCAGGAAGACTGCCGCATTCGTAGTGTGAGAGCGGGGCCCCGGTGGCGCACGTTGCTCAAGCACCTGATGACAGGCCTCAAGGACGGAG
AGTGCGAGCTGGATCTCTTGCTATATCACCACTTCTTGCACTTCCCAGTGCGTGGGGAGCAGGTCCAGTGGTATCCTGGCCTCGGTGAGCGACAGCGACC
CGCTGACCTCCTAGCAGCTCTCCGGATCGTCGACACCGCTGACCCATGGCGTAACCAGCATCGCGCGAACATTGTGGATCACCCCAGATCTCGCCTCATG
CGCCTCGACAGGAAGTTTTACGCCGCAGAATAGCGATTGAGCAGCTCGTTTTTAACATGTAGCTCCTCTCAGATAGCGTTGGAAGATTTCCTTCGATGTC
TCCTCTTGTACTCACTTTAACCAATAACCCATCGAGCATTTGTGCGGCCACCCCGCACAAATCTCTCCCCTTTCGCACCTACTGCGAAGGGTCTCCACCC
ACTTCTTCTTTGTGGGATTGCATAACGCCGAAGCTGTTGCGGCTGACCTAGCTTCTTTCGAATTCGCGAAACGACGCCCCACAGTTCAAGTCAACCTCGT
CCACCCACGTCGGATCATCATACCCCTTCCAGTGCACCAAGAACTCGCGGCAATTCCGTCCGTATCGCGTCTTCCGAGATGATCGTACGTCAGCAATTCG
CTCCACTTAGTACTCATCCTCGTCTAACTCTCGTTCCCAGCTGTCCTCCGGCAAGAAGGATTCATCGAAGTCCACGCGATCTTCATCGGGGGCGACGGTC
TCCACCTTCGGGCGGTCAAGGAACTGCTTCACCAGCTTGAATTTCGACACGTGCACGATCGGGAAGATCCGGTATTCCGTCCCTGCGATCTCCAGCTTCG
CAGCATGTTGATCGATCATCTCAGAAACACGGGATGGCCCATGCCAGAGGTGCGCAAGCTTCCGGGCGTAGCCACCCTTGACGCGGTCCAGATACAGCCA
GACCTGATCTCCGGCCTCAATGTGGTGTGGACGAAGATCTTTGTTGTGGTGATCGGCGCGCTCGCGGATTGCTTCGCGCATTCGCTCGTTCACCTCCTCG
CGGGCCCGCTGGTAGTGGCTCTGCATGTGGTTACGCCATCTCCGCGGATCGCGATCTCGGCGACGCGTGCTCCCCACAGGCAACGCTTCTTCCAGAGTGG
ATCTCGGATCCCAACCATGGACAAGGAAAAACGGCGTATCTCCCCGAACTCGATCTTGAGCCGTGTTCAGCGCGAACGTCAGCCGCTCGGCGTACTCGTC
CCAGTCCTTCTGGTTTATGTCTGCGACATACATTTTGACTAATCGAGTCAGAGTCTGGCTCTGCCGTCCCGTTGGCCTGAGGCCGGTAAGCCATCGTCGG
GCTTTGTTGTTGACCCACAATACGATTGAACGCACGGAAGACGTCTGCCATGAACCCAGGCTCGCGATCGTGCCGGATGACTTCGCTCGCCCCAAAGCAA
CGGAAGACTCTCTCCTCATAGATCTGGGCAATCTGTTGCGCGGTCCGGGCGCTGCTTGGTTTCGCCAGCACGTACCCGGTGAACAGGTCTACCTAGATCA
AGAGCTCCGTGTTCCCTTTGTACGACTTCGGGAGCGAGGGGATGTGATCCATAGCGATGATCTGGAACGGGTAAGTGGCCTGCAGGTTCCCGGGCGATCT
TCCCTGAATGATAGGTCTTCCTTTTCCAGTCTCGCAGCCAACACATTCATCAACGTATCTCTGAACATCTCGGAACAGGCCGCTCCAGTGGAAGTGCTGC
TTGATCCGCGCGTACGTTCTTCCGATCCCCTGATGCCCGCCTTCAAGGCTCGCATGGTAGTGATGCAGGAAGTCTTGGCGCAGCAATTCCGGGACCACCT
ACGTGGCGACAGCGTCGCGATCTTTATCAGATCTAGACGTGGAGATCGGGCAACACAGCAGGAGTCTATCGTCATCTACCTCATACGAGTCAGCGATCTT
CGCACAAGTCCGGGCGTCCTTCGCCGCCAGATCCGCCACGTCCCCTGTCAGGTACGTCTTCAGATCGGCGATCCACGCCTCTCCCCCTTGTGCTTTGACG
ATGCGTTTTAACCTCATGCTTTGAACCACTGATTCCTGCAGGCATTCCGGTGGAGCACGCCTTCGTGTGGACGATCGGGTCACGGCGGAGACACGGACGA
CGTTCTCCTCGTTCTTCGGCTTCAAGATCTCTCCAAGCCGATTGAGTGTGACCAAGTCTTCGCCTGCAGAGCTTCGCTGGCGAGACGATCGGCGCTCTGG
TTGCATTCCCGCTTCACGTGCACGAACTCGTGCTGAGGCCACGACAAGAGTTTGCTCGTCGCTTTCTCGCGCAGGAGCTGCAACGCTGGCGCCTTACATG
CGATCTCGCCACGCATCTGCCGGATCACCAAGTTGGAATCTCCGCAGATCACCAGGCGTCCCCTGTCAAGAGGTGACAGGAGATCCAGGCACAGAAGCAG
TCCATGGTACTCAGCTTCGTTGACGGTCATCTCGGTCGCGTACTGAGACGCCGCCGTGAGGATCGTCGACTCTAGCAGCTTCCAGACGGCAGCGCTGTAT
GCTCCGCCGCCACGTTTCACACGAGCAGACCCGTCAAAGCTCACGACGATCAGCTCTTCATCCAGTTCGACCGTTGGCGTGGGCGCGACGATCACTTGCC
GGGGATACTTCCTGGGGGCGACTGCAACCAGGGCTTCATCTACCTCTTCCCGAGGGGTGATGCTCGCAGCCAGCGTTCCCAAGCCTTCGTCTTCGCCCTT
CGTACATCGCACGATCTCCAGCGCCCATTGAGACAGGAGTGCAGCCCATGAACCGAGACGACCTTGAAGACCTGAGGGTTGAAGCAGCCAAGCGAGCGTC
GAGTATCGCGACAGCACCTTGATCGACTTGGCGACCAGCATGGTGTGGCAGACGTCGAGGATCCGCAGCAAGGCCAAGACCTCCTTCTCGACGATCCCGT
AGTTGAGTTCGTTCAACTTCAGGATGCGACTGGTGAAGGTCACTGACCAGAACACGGCATCAGGTTCTTGCATGAGAGCCGCGGAGATCGCCCACTTGTT
CGCGTAGACCACGATGACTGGGGGGCGATCGGGATCGAAGTGCTTCAAGGTCGGGGTTGACACGATCATCGCCTTCAGCATGGTGAACGCGACGGTGGCT
CTCGTCCAGCGGTCCTCCTCATCCTCTACTTGGTCAACGCCCCCTGTCTGCAATGGACGGTCCGTGATCTTGCTTCGGCGGCGAAGCTCGAAGAAGTCCG
ACTCACGCAGCACGTACAGGATCGCGGCGTACACTGCGAAGTCCTCGATGAAGCGGCTGTAGTAATTTAAGCTGCCGAGGAACGACTGCATCACGCGCAG
TGTCTGCGGGAACGGCAAGTTGCACAGCGCCTTCACGTCCTTGGGCCGCGCTTCAAGTCCTTCGATCGAGGCTCGATGACCAAGATAGTCCACCTTGCGC
ATGCCCCAAGAACTCTTGACCATGCTGATGGACAAATTCCAACGATCGCAGGCGTCGAGCAGCTTCTCGACCTTCCCGCAGAGATTGTCCCACGAATCTG
CAGTGACCAAGATGTCGTCAATGTACGACTGCCGCCCTAGTACCGAAGGTTTGTGGTCCGTCTCCGGCTCGCCTGCGTCGAACACGTCAGCACGATCTTC
GGAGTCTTCGCCATTGCCGATCCGGAGGAATCCATACATGACATTGTCCAATAACCGCTGGTAGATCTGCGGTTCTTCAAGCCGAACGGCATGCGGGTCC
ATTCGAACAATCCGAAGGGCGTAATGAACGCCAAGATCTTCTGAGCGCGCTCTGTCATCTGAACTACCCAGAATCCGCTTGTCATGTCCAAGAAACAGTA
CCAGAGGACCTTGTCAAGATCTTCAAGGAGATCGTTGATCAAGAGCATGGGATACACCATCGGTCTGGTGAGGGAGTTCACCAAGCGGTAGTCGATGCAG
AGCCGAATGTCCACCCCGTTCTTCTTGATGATGGTCACGATTGTAGACGCCCATGAGGAGGTGGAAGGAACGATGATCTTCGCCGCCAACAGTCCCTTAA
TAAGTCGGAGAGTTTCTCGCGAAACTGTGGGGCTACCCGACGAACGCGTTGCGCGATCGGGGCCACACCTCCCACGTCGATGTCGCATACCACCCCTACT
GCTGCTGGCGGCAAGGCGTTCCCCTTCCCGAGCAGAAGATGGTTCCTCCTCCAGATGATACGCCTCAAGCGGTTGATCTCCTCCCGCGTATTCCACTCGG
GATCTCCAGCCTGGATGTCTTCCATCTTGACTTTCTCTGTCGTGCTCACGATCTCGGGCAGGACAGCCATCTGTCCCTCATGATCTTCCGCAACGAGACT
TCCGCCATGGTGATAATACCCTTCAGCATCTTCCCGGATCTCGGCGGGTTCTTCCGAGACGTCGGTCGTTGGCTTTTCTTGGGGTTCCGTAGCGACGTCT
TCAGCTGGAACGGGCACCGCCTCTTCGTGGTCCAAGGTGGGGTCAGCTTACGGTTCAGCAGAGCCCTCTTCCTTTACAATCTCTGGATCACCTCGGCTTG
CGGTCTCCTTCCTCGAGTCCTATTTGCCTTCTAAGGCTTCCTCGTCGGCGTCCAGAAGGTCAGCCCAACGTACGAATGCCGTTGCGACCACTGGCCATGA
GGGGGGGCTCTTCTTGTTCCTACCGATCGGTGGTCGGTTCGAACGCGAGAGTTTGCCACTCCGCATATTGACGCGATCCCACCGATATGTGACCCGGCAC
ACGGGGAACCAGATCTTCGGCCAGCCACATTCCCAGTTCGGTGCTCCGCGACAGGTGGAGCTCTTGATCACCGACGTTGGTGATCCGCAGGTGTCGCCTT
CGTCCAAGCCCCTTCACGACGGTAGGTACCCATTGTTCTCCACAACTTCTCTCGTTTTAACGCGCGTGGTGGCTTCAGGGGAACTTCGGCAGCTGCTACG
GGGATCACAACGTCGTCTTCCAGCAGCAGCGAGTGCCTGCTTCGACCGTACTGTTGGTGGTACTGAAGCACTTCAAACCGCCCAGCAGGATACGACGGAA
AACAGTAACGAGATCGCTGAGGGGAAGACGATAACGCGCGCAAGGAAACGTCCTCGCAAAGAAACTGCTTAATTCCTCAGCAGGCCGTAGTATTGTTCCC
GGTAGTTCAAAATGATGCTAGTTGACAAAATCTCTAAAAATAAAATATACATCTAAAATTTGAAATTATCAGACTTCAACATCAATTTTGACGAAGAAGC
CGACGGTTTTGAGCGCTATAATTGGTCCCAATCGATTCGTCTCGAAATTTTACACTGGACGCACCAATAAAAAATAAATACGTTTCCTGGAAAAATTCGA
AGGTCGATTCTTAGATGTACTTTGCTCAGCAACGGCTGAATGAAAAAATATTATTTGAAGCCAGCATTCGAAAGAGGGAACACTCCTCTTTACTCTGATG
TACGCAACTCCCGTTTTAGCAAATGGTTAACTAGCAATGTTTTGTTTTACGGGGCCTCAAATATGCAGAACTTAGAACGCTCGGCTCGTACCAGATTCCA
ACCTGGCGAGCGTCCTAGTTTTGCATCTTCTCCGCCTTCGAGGGGAACATCCCGGCGTGACGCGTGGGATCGTACCACTGGCGAATCAAGTTGTAAAACG
CTTCCATCGGACATTCTCCGGCTTCATGAACCTCACCGCACGCTCGGCAAACGTACAAGCAATGGTCTCCCGGATGGCCCTTCTCCCACACTTCTGGCAA
GTCAAACGCTCCCAGCATCCAAGATCGGAGTGTCTCGTGGATCCGCAGTAGGAACACTTCTCCACACGATCTTCAGTTCGGGGGCGAGGGGGTTGATCCG
GTTTGCTCGGCGGTCCCTGAGGATCGCGACGTTGCTGAGGTCGATCTTCCGGCTTCCGTTGGTCCTCGACAGCAGCGAGGTAGACTTGATACCGACCTTG
ATCCGAGTCCGATCCTCCGGACTCTGACTCCGATCCCGAACTGTCGATGTCGTTCGTCATGCGAATTGCACGCACAGCTCGAGCATGTTTGGACGAGGCT
TGCGAAGGTGTCTATGGAGCCTTCTGACGGTACTTGGATGATCCAGCGGCCGCCTTGCCTTGTCGGGCTTTCGCTCGCTGACGAATACGCAATACGTCCG
CCAGTGCGTCCCCATCTGCAAGGCGGAGCAACGTTAACTGGTCGGCAAGATCGCGATCGTCCAAGGTCTCGATGAAGTGCTCCACGTGTTCTCGGAGCGC
GGATGGCGGTCCAGTCTTGGTTGGCAACTTGGCTCGGAGTCCCAACACGGTCAGGTGGTGGAGATACTCGAGCGGCAACTCGTCGGATCGTTTCCTCGCG
TGGTAGTACCGCCTCGCGAGGGACACGCCCAGCCCGCAGTATTCGACTCGGAAGCTGTCCAGGAGATCCTTGCATTTGTCACGGGTCGATCTTCCCAGTT
GCTGGTACCAGTTTCGCGCAGGGTCAGTGAGCAGATTCCCGAAAACGAAGCACTTCTCGCTGTCAGGAGCTTGATCACGGATGAACGCGGACATCACTTT
GCCCAGCCAGCTTCGAGCACGATCTTCGTCGGTGTCTCTGCCAGAGAACTCCTTCAGCTCGGAGATCGCCGACATCCGGACGCGAGGGATCACTGATGCG
TTCTCCGACGACGTGGTCGTCTCTGCTGAGGCTACAGCAGCCCGGCGTGGGACGTCGATGCTCAAGTCGTCGGGATCAGACTTGTCCGGGGATCCATGGA
ATAATTTCACCGATTCCAAGTCAACATCCTACGCCCCCGGCGCCGTCGTCTTGGGCTGGTTAGTGATCGTCCCCACGACCTGCTCCTTCTGGAAACGTTC
CATGGCCGTGTTGAAGAGCGACTGCATACGATCAGGACTGTGGAGATCGGGCGTCGCCCTAGGCGTCGCCCTAGTGTTGACGGGCCCCTTCTCCTCCTTG
ATCTTTATTGCTTGGAGCATGGCAGCACCGGATGGACCAAGCGTCATCCTTGTTGGCTCGATCGCCACATCCGACCCGACGTCCGAGGAGACAGACGCCT
TCGCAGATGCGAATCCTGAGTGCGAGGATGCGAAGGTGGGGTACCCTTCCGTCGGACCAAGGCTCGACAGCGGCGCAGTCATGCCTACCAAGGGCTTCAG
CAGCTTGAACAAGCGTCTGGCCGACTCGTCAACATTGGTCAGGCTGAGCTCGAATACAGCTTCCGCATCGAATGCACCGGCGACGATCCCAGATTCTTCC
AGCATGTCCATCAGGCTAGTGATCGCGACCATGAGATCGGCTGCTTTGACTGGGGAGGTCACAGGGCCTTGGGGTTCTCCGATCAGCTTCGGCTTCATCA
CTATCACCACGGGATCTTCCAGAAGGAAAGCGTTGGGCTGCTTCCGGTAGAAGATCTCTGTAGCTGATCCAGACGCCAAGTCCTGACTTCTCCACTCTCC
TCCGCGTCTGGAGCCCTCATTTTCGGCTTCGTCGTCGACTTCTTCTTCGTGGAGACGCGGGGTGTGGGGAGAGTGGTTGTGGATGAAGATCCTTCCGTTT
TCACGGATACACCTTCATCCGGCGGATCACGATGCGCATCGTGATCCCCCCCCCCTCCCCCCCTCCCCCGAAGGGTTCAAGGGAGGAGGGTGAGGCTTCT
CTTCCAGGTCCATCGCTGAACCTACCTCCTGTTCCTCACCAGAGTTCCTCCCAGTACTCTATTGTTCGATGTATTCTTCACCCTTCAGATTCGACGACGA
CGATTCACCTTCCGTCGACGCGCCGGTTCCCGGCTCAACTTTGATCTTGGCATCTTCCTGGCTGGACTCATGGTGATATCCGGAGTCACCAGAAGATCCG
GGCACGCGCACCATTGTGGCGTAGTGGTTCGCGAGGATTCTCGACGCGAGGGACACTCACACACTTGGCGTCCGGACTCCAGGCTGACGGAGGGGGTACT
CCGCTTGCCGTCTGAAGATCTTCTCACCTTGTGTACCCGTCGGGTTGGACGATTACGCTCTTCTTGGGTGGCTCGTGGAAGACGCTGGGTTTGATCTGGG
TTGAGTATGT