Description :
From Genome Similarity Track
Location :
Scaffold_251:42669- 44506
Transcript NameFunction/comments
Phyci_569045Hypothetical protein

Sequence
1837 bases(100 bases per row)
AGCGTCGACAATTGGCGTCGCAACCGCGAGCGAGATCGGCCCTGCAGGCAGCGCTGATGCCGTGATGGCCGAGCGCGCGCCTCAAACCAATCAAGCCTTC
GAACACCGGATCATGTGGACAACAGGAGGACCTGGTCGATTGATCAATCACCGTTGAGGTCGTGAAGACTGCTGAAGCTGCAAGCGCGGTGTGAGCATGA
ACGTTGACTCGGTGCCGAGGCTTTGCGGTTTCTAGCTGTGAGCTGGGGACGCTGAGCAGGACACCACGAAGACTGCTGAAGTTGAGTCGCGCGAGACTTT
GCTAACGCAGCCATCCGATGCCCCTGATATCTCCGAGGAGTGGGGAACGACGGCCATTATTGTGACGCTGATTAATCGGCTGGTTGAAGCTCTCGGCAGG
CACGTGTGAAGTCCGTGTACACTCGAGCAGTCTCCGCCAACTACGAGGCGTGCCGACATCCTTGGCGCCGCCCTTTGCGAGAAATATGTAGAACCCGACA
CGCTTGTTGCAGCACTGCTGCATCCTGCAGCAGCAGCAGGATGCTCAAGTCAGGCTGGGTGATCACGGTGATCATCCATCACCCGGCAAAACTTTACCGC
ATCAGATACAAGACCACTTGTCTCGACTGTTGAGTCGACATGCCTTCAACCACTTCGATACTGCTGCTTGGTGGGGGCAGCGTAGGGCCTGTGTAGCCGA
GGAGGTATGCACGACGAATTGTCCATCTCTTGAAAACTGGTGCACAACAACTTGTTGTGCACCAGATTATTGTCAACAAGTGTATCGGTCTGAAGGCGTA
GTACCTTTCCTGGTGGACGCTTTGCCCCGCCACAGAGCGACCCGCTCGTGACACGAAGCTCCGGGCGTCGTGCCCAACCGCAGCAATACATAGCAGTTTA
TTTTTGCTGTGGAAGGGAGGCCATGGGCAGCACTTGGAGTTCAAACAGCTTCTTCTCCTTTTATTCTTCATCGCCATCGACCTCGCAACTTCAAAGCAAA
GACGTGTTGGCGCTGTGCGAAGATGGCGACTTGCTTCTTGCACGCGAGAAGCTCGCTGACTCGGCATTGCGCGTGGGGGTTGAGTTTGTCGTGGCTCGGG
ACATTCAACGCATGCAGCGTGGGCAGTTTCCTTCTCAGCGTGTGACGTCCTTGCCCCGTACGTGGTGTTAACGTTCGACTTTGGTAGCGTTCTGGTTCAT
TGAGGCTAACTTGTCATGCCGCATGTTTTCGCTCATCAGCGTGGACCAGGTGAGACCGAGCTGCTCCAACTCGATGTCAACGGCGATGCGCTTCTGACTT
CGTGCCCCTTGTTTTCGATGCCAGCTGCGAGCTGCTGCTACGGCACGAAGGTGCTCTGCGAGTCATCGCAGTTAACGCGAATGGACTTGAGCTTGTTCCA
TTCGAGGAGCGAGTTGCAAGCAAAATGCCGCATATTCACGATCGTGTAAGGCCACCACCGAAGTTGAGCATATCCGTGTTTGCTAATCTGTCGCTTGTAG
TTTGCAATTCGCCGTCTTCAATACGACGCGCGTAGTGAAAATTTGTCGTCGGCATTGCGTGAATTGGCGCTGCAGATTGCCTCAGTCGCCCCGATTTCAT
GGCACTCGCTGCTGTTCCCTAGCGCAGGGATGGCCAGTACTCCGAGGTCTCCAATATCTCCACGGCAGCAGTCAGTGGATCGAGAGGCAGTTGTGGATGC
ACTCAAGGTGCTGCCACCACTTGTTCGGCAATTGCTGTGGCGAACGTTCGAGGTAGGACGTGTCATGGCCAAGGGCTATTTTTCAACAACTAAGCTTTGG
GGTCTGGTAGCTCCTCTGTCTAGGACTGAAGGATATC