Description :
From Genome Similarity Track
Location :
Scaffold_329:42663- 48557
Sequence
5894 bases(100 bases per row)
AAAGAGTCACTAATACTAAGTTCCTTATCCAAAGGACACTTACAGCCCAAGACCAGGGCTCAAAGTTAACACCTTAACTTTTATGCTTCAAAACCAGAAG
TGTTTTATTTACTATTATTGCGGCCAAGCCGCCTAGGGGTAAATGTATCTCTTTAACTATCTAGCATAGTTAAACCTAATCAAATGCATAACGTGTGGCT
TTCAGCCAACGTACTGAGAGACCTTGTTAACTCTCCAACTTATGTACTGAGAGTTTGTTAACTCTCCGGGTACTTCGTACCCCTGTGTGCTCCACACCAT
GTAACCCCGTTACAGACTCGGCACTCCCATCGGGGCATCTTCGACTCCTCGGATGAAGAGGAGGAGAAGGAGGAGAAAAAGGAGGAGGAGGGTGCTATCT
CTGAGCCCCGGGAGGTCACGAATGACCTCGACCAGCAGCAGGAGGAATTCCAAGCTGCCCAGCGTGTGCGTGGGGGTTGGGTAGTAACACCCGTCAGCCA
GGGATCTGCCATCAACTCAAGAGGGTATTGGCCTCCCGAGGAGAGCTCTGGGGCTGACCTCTTCCTAGAGCTTCTCGTCGCTCCTCGTGATCTTGTGGGC
GGACACACTTTTAGGGGTGTTTACGAACGTGCCCTTGTTCAGCAGGAACAGTTGTTCGTTGACAACTTGGAGGCTGCTCGGTGTGTACTTCTCGCGCCAC
ACCGCATCCCCCTTAAGGACTTTACGACTTGTCGTAAGAAGCCCGAGAACCGGGGTGGGCTCTATCCTCTTTGGGGATACCCCTGGGTTATGCCCGAGAA
CTGCCCCACCTGGGGTTCTTGTGAGGACATGTTCTGGGCATGGGTGGAGTCTCTCAAGTACTCACCCACAGAGTTACGGGAGCTCCATGAAGACTAGCTG
CTGTCTCGTATCCTGGACCAGCGTGATCTTCGTGTTCGGTTTGCCCACTTGGTCAGCAAGCGCATGCTGCCAAGGGACATCCTGAAGCGTGCGGCTTCCA
GCGCTCACGATGAGCGCGGGTACGGAGTGTATTCAACGTCCGTACCCCGTTCGATCAAGAAGCCCAGAACTACTTATGAAGCTGCCACCGCTTTTGTTCC
CAGATTGCGACAGCCTTCGGGCAGTCAATCAGGAGCCGTTCAATCGGCTCCCACGAGTTCTCGGAGTGGGCATAACCCCTCCATTTCACGAGGAGCTGTC
GCTTACCGCGACGCCGTTGCTCCTGGAGGATCCGCTCCACGTGGAAGTGGACTTCTCCATTCCGATCAAGCAGGGGCGGAGGCGCCCTCGTACGAGTACG
AATACTCGGCGCCTCCCAAACGCCACTCTCGTCCGAGTGCTCCGGCTGCGGGTCCGACACAGGGCCCTGAGGTTGACCGCCTCCGTCAACTTGTCCTCGT
GCTTGAGATTGCACTTGGCCTTGGAACTGGCGGTGATGCTGCCGTCCAGGCCGGGAATCAGGGCGAGCTCGCTCGTCTTGCGGGCCGCCTGGACCTGCTG
GAGCGTGAGGTCGCGAGCCTGCATCTGCGGGGGGATCGCCGGTCCTCTTCGACCGATCTGGACGAGGCCTTCCGCATGATCCGACGGATCGAGACTCTGT
TGCCACGTCTGGAGCCGCCTTCGACGCACTCCCAGACGTACGCGTATGGTGCGTACCCGGCGTACTCAGCGTACTCGGCGTATGGCTCCGGGGTCCGTTC
GTACGGAGCCCCTCCTGCGTACGGTCTTGACCGCAGTTTTGCCGTCCAGACCGAGGCTTGGGCGCCTGCTCCGACGCCCTCGTCGACGTCTGTGACCGGC
CCTCGCTTTGAGGAGCTGGGCCAAGGTGGGTCTGCGAGTCAGCAACCCCCTGCGGATCAAAGTACCGCTTAAGACGTCCAACATAGAACGTCGGGTGCGT
CGTTATTGACTTTGGCAGGTCGATGGTGTACGACGCACCATGTCTGGCCAGGACTGCAAATGGTCCGATGAAGCGGTGCTTCAGCTTGTTGCTGCCGACA
GAGCTGACAGTGTCAAGAGGTAGGTTCCTCGTGTCTAGTAACACTAAGCCCCCCACTTTAAATACACTTAAGTTCCTCTTCCATGTTTGTCGGAGTACTC
CTTTTGTTTATCCTGGGCCGCTGCCATGGCATCGCGGACCCTGCTGACAACGCTCGGCTTGGTATCCATAAAGGATTCCACTTGTTTTCGCAGCGAAATT
GGTCTCACATCCGAGACCTGGGAGGAAAGGGCTTTCCGAGCCTCTCCCCCACTTAGAATATAGGTGTCAGTGTCTCCTCGAAGAGTGAGAGGCACTCTGG
GGTGCCGGAAGCCGTTCAAGTAGAACGGCGTAAACCCCTTGGACGCGCGCACCGCGTTGTTGAGCGCAAACCCAGCAACTGGAAGCTGCGTCGACCACGT
ATGTGGTGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTCTGTCTGGCCGTCTGTCTGCGGATGGTCCGCAGCGGACATT
TGCAGACGAGTTCTCAGTAAAGGAAAGAGCGTTTTCCAAAACGCAGCCGTGAACCGCGGGTCTCGGTCCGAGACAATCGTCTCCGGGAGACCGTGATATC
GGAACACGCCATCGACGAACAACCTTGCGGTTTGTTCGCCCGTAACAGTGACGGGAACCGGAGCAAGATGTACCATATTGCTCAGCCGACACACGAACAC
CAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCATCGACTTCCAATAGTCAGCCGGTACGGGCAGGCTCTGTAGT
GGAGCCGAAGAGTGGCCTGCGGGTTTGACCCGCTGACATGTTTCACATGTCTTAAAGTATCGAGCGACCCACTTGTACATGTGGGTCCACCAGAAGGCCT
GAGAGACCGACAGAAAGGTCTTCTCGCGGCCCAAGTGGCCGCTGGAGGGTGCGTCGTGCGCCTCCGCGAGGATATCGAACTTCAGATCCTCGTCGTTGGG
TACGACCACCCGTGGAGGATCATTGGGCTCCACCCGGTAAAAGAGGAGTCCATCCTTCAACTCATATCGGTGGAGCCGTGAGCGCTGTCGCGACGAGAGC
CAGTCGGACTTCGCGCTCGTTCCTGCCATAAGGAACTTGACGATAGGCGCAACAGCCTCATCGTCCCGATCCGCCATGCGTATCCGATCATTTAGATCCG
TTGTCTGGGCCAACTCATAGTCAGGACGCCGAGAGAGGGCGTCCGCAAGCACGTTGAGCTTGCCCGGCTTGTATTCGACGTGGAAGTTGTACTCCGTGAA
GAAGGACAGCCACCTCGCCATCCTTTGGGAGAGGTGAGGCGAGTTAGTCGCCGTCCTCAATGACGCGTGGTCTGTGTAGATCACAAAGGGCCGGGAGCCC
AGAAGGTGAACACGAAACTTCACAAGGGCATATTTCATTGCCAGGAGCTCCTTGTCGTGGACAGGGTAGTTCCGTTCGGCGGCTTTGAGCTGCCTGGACT
GGAACGAGATGACTCGTTCATGTCCGGCCGTGTCGGCCTGCAGCAATGCACACCCGATGGCGTAATCGGAGGCATCGCAGACGACGCTAAACGTCTTCGT
CTCCTCCGACAGGGCCAGGACAGGGGCCTCTTGGAGACTGGCCTTGATGCCGTCAAAAGCATCCTGGTGCTCTTGCTCCCAGCACCAGTCGACGTCCTTC
TGAAGGAGGCCCGACAAGGGCTTAGCGAAGCCCGCGTACCCTGCACTGTACTTGTGAAGGTAGTTGGCCAAGCCCAACCGCTTCGAAGATCCTTTTGGGA
TCGGGGCGTTGGCCATGCTGCTATGGCCTTGACCTTGTCTGGGTCAGCCCGAACGCCCACGTTGCTTACGAAGCAACCGAGAGCTTTAATCTCTGGTGAC
GCGAAAACGCACTTGTCGATGTTGGCGTAGAGCTTGTTTGCTCGCATTACGTCCAACACTCGACGGAGGTGCCCCAGATGCACCTCCATGGCCGTCTTGC
CTCCCTCGGCACGGTTATGGACGAATATGTCGTCGAAGTACGTCTGTACGAAGGTACGCAAAGGTCGGAACAATTGCATCACCAGGCGATTGAACGTCGC
CGGGGCGTTAGACAGGTCCTGCGGCATGACGAGCCACTCCCAAAGCATGCCGCTTGGAGTGCTCACCGCGGTGAGCGGGATGTCACTCTCTCGCATCAGG
ATCTGGTAGCATCCGTCTACCAAATCCAGCGCACTGTACAGTACGCTCCCGGCCTTGTTGTCTAACAACACATCCTTTCGCGGGATTGGTGTTTGGGCCG
GCACCGTTGCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGCCACTTTCCGTTCGGCTTCCGAACGCAGAAAGTCGGTTCGAGTGCGGGGATTTCGAC
TCCCGCACCATGCCTGCCTTTGCTTTCGCGGCGAAGAGGGCATCAATGACCTCGCACTGTTTGGGCGGGAGAGGCCATTGCCTCGTGACACAATACTTTG
TGCCAGGCACGAGATCAATCTCACACCGTACATCTCGATCCGGTGAAAGTTGGGTCGGTGGTTGTTTGTTCACCACGTCCGCATACTCCATCGCCAAAGG
ATACACCGGATCCTTGGGGTTCTTAAGGATCTCAGAGCCCAAGCGCGTCTGACGCTGCTTGTTTAGGTATTCCAGGACGTTCTCGGCTAAGACAGAGGAG
GAGTTCAGCTCCTCCCGAGTGGTCTCAGGTCTCATGAGTACCATCTCAGCAATCTCTCCAGCGTTGAGGTTGGTCAGGAAAGACTCAGCCGTCATTTACT
CGAGGTTCAGTATCTCTACAACCTCTGGCAACGGTTCCAAGGGGACACCAGATGCCTTAACGGGTAAACCGGTCTCGCCATCGAAGATGTGACAACACTC
TTCCACCGGCCTTGTCAGAGGAGCCCGGGCCCTGGACTCCGAGTCGCTTGAAGCGACGTCGATCGGAACGAAGTTCGGATCCGACTTGAGGCGGCGGCGG
CGTCGTTGACGACGGCGACCGTGACGTCGAGCTTTGCTGCCCACGCCTAGGGATGTCGGCGCTACGACATCCGAGGCACTCGTGGCCTCGTGTGGTACCG
TGGTACCCACACAGGAAGCGTGTTCAACGCCTTCCTCTTCAGTTAAGGTCTGGGCGACCGCGTGTGGCACTGTGTTACCCACACAGGAAGCGTATCCGAC
GTCTTCCTCTTCAGTTAAGGTCTGGGCGACCGCGTGTGGCACTGTGTTACCCACACAGGAAGCGTATCCGACGTCTTCCTCTTCAGTTAAGGTCTGGGCG
ACCGTGTGTGGAACTCTGTTACCCACTCTGAACACGCCGTTCTCAGTGTTCGTGACAGCTGCAGCTGTCTGCGGAACTAAGTTACCCACTTGGCCAGCGC
CTCCCCTGGGCGCTGCCACCATCAAAACATCCTCGAAGACGTCATATACGCCGACGACTCCCAAGCATTTGCCGAATGCTTTGGTATCCTGGCAGCCCTT
GCGGGCGCCCTGGGTCCTGACAGAGGTGGGAACATGACTCACCAATGCTCTGTCGGACTGCGAAGGGCGGCTGGCACCGATTGCCTTGCCTCGCCCGTCG
ATCCAGGGCTCGTGCTTCTCAAGACAGGGCATGCCCAGGATCATATCATATGGATCCATATCGAGAACAGTGAACTGTTCGAGGCTGTCAAAGTCTTCAA
ACTTGACGGCCAGATCCACTTGGACGTTGGGGACAGTGACGACCTTCCCGTCGGCCAGTCGTACTGACACCGTCCCGTTGCCCTTGCTTCCTCTCAAAGC
ATCGGACAACTTGTTGCTGTTACGATCAACCGTCTGGCGGCGGGCGAAATTCTTCGACGCCCCAGAATCGATCAAGATTCTAAAAGGATGATCG