Description :
From Genome Similarity Track
Location :
Scaffold_1539:4266- 5894
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1539-fgenesh-gene-0.0Pc13g10860 protein
Pytar_ATCC12531maker-par_contig_1539-fgenesh-gene-0.4Histone acetyltransferase
Pytar_ATCC12531maker-par_contig_1539-snap-gene-0.8Gene of unknown function

Sequence
1628 bases(100 bases per row)
ACTGCCTTCGCCTCTGCCGAAAGCGATAGCCTGGGCCTTCGCGACATTGTGCCGACGCTCATGCTGCTGCTGGGCCAGTACCAAGAGGCCTACGACATTA
TCAAGTGGTACGCGACGTCCGGCCATGACGACCACTACGACTGGGGCAATATGGAGCTGCCGTCTCTCAACGTCCACGGTGCCAACATGACCGAGATCCC
CGAGACGCTGCTGAAAGGCCGCGAGGTCTTTTTCCTGAGCACAATCGCCTACATCAAGATGTATTTGATGAACGCCGTCCAGGACGCCATCAACACCCCG
GGACTGCCCCCACGTCCGACACGCTTGGTGCGATTCTAGCGCCAAATGGAAGGGCGCGCAGTCTTACGGAACTGAAGACGCTTCGCAAGACGCTCTAGCG
CCAGATGCATCGCGCGTTGTCGACGTCGCATTTCCAGAACCAACACTTTTGGACGGCGATGCTGGACCCCACGCCGATCGCGGCGACGCCCAAGCCGCAG
CACTACGCGCCGGGTGATCCCAACGAAGTCCGACTCTGGGTGCTGCCGAACGCTATGCTCTGGCGCGACCACCACGCGTTTATTCGCGAGTTTCGCGAAG
GGTATCCGGATTTCCTGCCCGAGATGCCGCGACGCGGACCCAAGCTCCTCGTCAACTACCACTAGGGGAGGGGGCANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCACCCCATCTCTGCCCAATGTCGTCGTCTGCAAGGGTGCTTTGATGAGGAAGACGGGAGCCGTCGGTCTGTGCGTGAGCTCTTCGCAAGAGATCT
CTATTTCTCACCAGATGGGTACACTCCTAGTGGATTAATTTCAGCCAATCAAATGCAGTTTACATTGGAAAAACCTCGTCCGTTCCTACAATTGAGGTTT
TATTCTCGTGACATCCACACCACCACACTTGCTCGACACCATCACTCGACCGCTCTTTCCCCGACGCGCTCGCTGCTCCACGATGCTCGGTCGCGTGCTC
CCCACGGCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGCTGCTCTCACTGCCGGTACGCTTTTCTGGCCGGTT
TTCCGGCTTCCGTGGCCTTCGGGTTCGCCAAGATACTGACAGTGGTTGTGACACAGTGCGCCGCCCGACGCTTGCGGTTGCGACGCCATTCCAGCTCACC
AGCGTGACCGACGCGTTCGCGCAGCTGCGTGTGATCGAAGAGCCGCTCGCGAGCCACTCGCTCGTCATGGAGTGCCTCAACCGCAACGCGCGCCGCCCGA
AGAAGGCCAACCACGGCAAGCGCCCGTGCTCGCACTTCAGAAGACGGCAGAAGCGCCTCAGCCGCCGCAATGCCGCCAAGTAAACGGGAGCGGATGCCCC
GTAGACACGGCCAGGCACACAGTAGAGGAAGAGCGAGCGAGCGAGAGAGAGAGAGAGAGAGAGGGGAAGGAGAAATACACGCATAGAAAAAGGCGGACCT
ACCTGAGGAGCTCCTGATCTCAACATGAACATGGGTCCTTCAACCGTACACCACGCACACAAGCAAGCCGTTACCTGTTTTCCCAATGGCCTATGCGCAT
ACTCGTACTATCGCTCTTGTCCTCTCTG