Description :
From Genome Similarity Track
Location :
Scaffold_1470:4266- 5391
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1470-snap-gene-0.3Ubiquitin-activating enzyme (E1)

Sequence
1125 bases(100 bases per row)
AGCTCCAAGCCGAGCAGCTCTCTCGTATCCGCACGTTCTTTGGTGAAGACGGGTACACGCACATCAAGGACGCGTTCGTGATTGTCGTCGGTGTCGGCGG
CGTTGGCTCGCACGCCGCCCACATGCTGGCGCGGTCGGGCGTCGGGCGCCTGCGGCTCATTGACTTCGACAACGTGACGCTGTCGTCGCTCAACCGCCAT
GCTGTCGCGACGCGTGCCGACGTGGGCACGCCCAAGGTCACGGCCACGAAGAAGCACTTCCACGAGATCGTCCCGCACTGCGTCATTGAAGACGTCGTGG
CCATGTACGAGGCCGCGGCCGCCGACGAGTTGCTCGCGGGGAACCCGACGTACGTGGTCGACTGCATCNNNNNNNNNNNNNNNNNGACGACGTGCAGACC
AAGGTCGCGCTGCTTGAGGCCTGTACGCTCAAGAACCTTAAGGTCATCTCGGCCATGGGCGCCGGCGGCAAGGCCGACCCGACGCGTCTGCAAATCGGCA
CCATGCCCGACGCTGTGCGGGACCCACTGGCCACCAAAGTGCGGTACTTTCTCCGCAAAAAGGGTGTCAGCACGGACAACATCACGACCGTGTACTCGAG
CGAAAAGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGACAAGCCCCACGAATTTGGCAACGTC
GAGCGGTTCCGGCTGCGCGTGATCCCAGTGCTTGGTACGATGCCGGCCATCTTTGGCCAGGCCATGGCCGCCTACGTGCTGTGCGATCTCGCCCACAAAC
CGTTCGTGCCCGAGGGCGTGGGCCGCCTTTCCCGCGACCAGCGCCACAAGCTGTACCACAAGCTCCAGGAACGCGAGCGCGCCACGGGACAGCCGCTCGA
GCTCGACAAGGACGAAGTGGATTTTGTGTTTCAAGAAGTCTGGCGCGGCCGCAGCTCCATCAGCAGCGCGCGCCAGGGCGGCCGCGAACGCCTCTACCTC
GCCCGCTGGCGTCCCGAGCGACCACTGCGGCCGGATAACGTGGTCTTCATCACGACCAAGGAACTCGCGACGCTCGACGCACACGGGATCGCAGGGTTCC
CGGACGATGTGGTCGCCCGTGTGGA