Description :
From Genome Similarity Track
Location :
contig_120:42658- 44214
Transcript NameFunction/comments
g11371.t1hypothetical protein PHYSODRAFT_563428
g11372.t1hypothetical protein PHYSODRAFT_563428

Sequence
1556 bases(100 bases per row)
GTTGTAGTACACCGTATTCTCGAACTCCGGCGCACAGTACGGGAACTCCGCCTCCTCGTCCGACGGAGCAAACAGCTCCTTGCCCGTCGTGTAAGTCACG
TAGCAACCAAGCACAAAGCAGATCACCACCACGATGCTTCCCGAGGCCTTCTCCCACATCGCAACCTCGCCCCACGACTTCTTCAGGTAGAAGACGATAG
GCAGCAAAATGCAGTTCACCGTGATGCACGAGGCACCAACGAAGTCTGCCAGGGACGTGAAGTCGTCCTTCAGCACAATCGAGATAACGACAAGCACCAC
CACGAGGATGACACGCAGCACGACGTACTTGATGGCGTTCGCACCGCGGTACTCCATCGCTTCTTTCTCGGCGTCGTCCTTGTGCACGTTCTCGGCGTCG
GCCACCGACACGTACGACATTTTGGAGCTACGGACAGAATCTTTCACGGCCGGGTCAGCCGGGGTAGACGTGTGCAATAGCTGGTGGCGTTCTCCAGGTC
CTCCTGCACCTCCTTGTGCATGCCCAGGAACAGACGCTCCGCGATGTAGAACGCCGGGTTGATGATCACCGCGAAGGCGATCGTGACGTGCAGCTGCATG
AAAAGGTATGCTAGCACGATGGTTCCCCAGTTCGGCGCAAAACCCAGGTTGGTGAGGCCGGTCTCCGAGTCGGGGTAAATGGTGAAGAGCAGGTTGCCCG
AGATCTGGCAGCCCACGGCCGAGTACGCGGTGCTGGCCAGGACCAGGAACAGGATAGAAATGATGCCGACGGTGACGCCCACGACGCGTGGCATGCGCTT
GGGGTCGCTGTGCTGGCGCTGGATGTCCGGGATCACGATGCCAGCACCGTAGGCGAGCGATAGGTTGCCGAAGCAGCCAGCGACCTGTTCGAAGGAGAGG
TCAGGCGTCGGCACGCTCGGGTGGCCGCTGAGTCCGTGCATGACCACAGCCACGCCGAGGATATCGGCAATGATCGTTCCCAGGCATCCGGCGAAGGCGG
CCCCAGCTCCTTCCTTCAGGGTGGGCACCAAGCACACGGGCAGCACCATGAGCGCCATGAAGATGATCCACGTGGTCTGGCTGAAGGCTCCCGGGAAGAG
GCCATCCAGCAGTGAACCACCGAGCACCAAAAAGACGCACGGGATAAGTAGGCACGAACCCATTTGTGAGATGATACACAGCCAGCGACCAATCGGCCCC
ATGCACCACTGGCCGAGGTCTCCAAATGTCTTGACGGACTTGGGCGCGAGCAGCATGACCTTGGACATGGTAATGGACGCGTAGATGTTGGCGAAGGCCA
TGAAAGCCATGGCAACAACGGCGAGGTAAGGGCCGGCGCGCGAGAAGTTGCCGGGCATACCAAGAGTACCAACGCCGTAGATGCAGCAGAAGAGGTTGAA
GGCCGACTTGGCGTCCTCAGCGGTGAAGAAAGGTCCCTTAGCCATGGTTGTCGGGGCGAAGGCGCGAGGCAAAAAGAACAGGGGCTACGGATCGAGCGCG
CTGCTGATCAGGGGTTGCTTGAGTTGGAGGCAGCCAAATTGAAAATGATGAGGTGG