Description :
From Genome Similarity Track
Location :
Scaffold_520:42650- 45766
Sequence
3116 bases(100 bases per row)
CGTCACACGAGGCCGAGTCCTGCATCTGATCATTGAACGGGGAGCTTCTGGTCGCCAGGCTCTTGACGTTGGTCGCGGTCGTGGCGATCGTGTGGTGACT
GACGTTGACATCTTGACGTGAGCGACACACACGCGCTACATGATTATCTTGCAGTTGTAGAGACTATGGGTGCCCACGACATCGCCGCCCAGATGATGTG
CGGATTCCGCTGTGTGATGTCGACTGTAACGGGTACGTAGCCCTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGTGTATGACACGT
CATACTCCGGGATATTTGGTACAAGGTACCAAGGTCGTTCAAAGCCAACCATTAGTCAAATGACATTGCATTTCTATAGGTAACTTATAGTTTGTATTAA
ACCCAAACTTAACCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTAGAGGAAGTTATCTTCCGAGAGTATACAAAC
CTCAGTGAACGGCAGTTCACATGTCCCCTCTTTATTTAAACTCCGAAGTTCGTTGCCATGGATAGGAACGACGTCTCCCATATGAACGACTCTCAGTACG
AGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCCCTGCAGAGCCTGGTGGTGTCAGCACCGGCTGAGCAGCTCGAGCGCGTCAATGCGTTCGA
CGCGTACGAGCAGGGCCTCATCGCGCATGTGCGAGAGAACTTGCAGGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGATT
AAGCCGTATGAAGGAAAGGAAGGCGAGAACCTTCACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTG
TTGCCTTTGCACTCTCCAACCTTGGCGGTCGTGCTAAGAGTTGGGTGTACACACGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTG
CGAACAGCTCCGAGCCGCGTTCCTCTCGGCGAACTACGAGTACCGCCAGCGTTCGCGCTTCCTCTCGTGTAAACAAGGGAGGCGTGAACTGCACGAGTAT
GTGCAGAGATACGGGAGCTCACGGCGTCCCTAGTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNGTTAGTTACACGGGATGTGGTACCGGGAATCACCGATTCATCCCCTCTCTAGAATCCTTGAATCGACTCTTGCGCGCGTCGGAAGA
ATTTTCCGCACGCCGCCCAGACGGGTTTGCTCGTAAACAGCAACAAGGTTGTCCGAAAGCTTTTGAAGAGAAAAGCAACGCGCAACCGCGGACGGGTGTC
CAGTCGCGACCTCGCCCGACGCAGCAAGGTTCGTCAACTGTCCCCCAACGGTCCCAAGTGGGATCTGCGCTGTCAAAGTTCTGAAAGTCTTTGACAGCCT
CGAACAGTTCACTGTTCTCGATATGGATCCATATGATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATGGACTGGCGAGGCAAGGCA
ATCGGTGCCAGCCGCCCTGCACAGTCCGACCGAGCATTGGTGAGTCATGTTCCCACCTCTGGTAGGACCCGGGGCGCCCGCAAGGGCTGCCAAGGTACCA
ACGCATCCGGCAGATGCTTGGGAGTCGTCGACGTATATGACGACTCCGAGGATGTTTTTATGGTGGCAGCGCCCAGAAGAGGCGCTGGCCAAGTGGGTAA
CTTAGGTCCACAGGCGGGTAGCTTAGTTCCGCAGACAGCTGCAGCTGTCACGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACG
GTCGCTCAGACCTTAACTGAAGAGGAAGACGTCGGATACTATTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAG
GCGTTGAACACGCTTCCTGTGTGGGTACCACGGTACCACACGAGGCCACGAGCCTCGGATGTGGTAGCGCCGACGTATCTAGACGTGGGCAGCAAAGCTC
CCCGTCACGGTCGCCGTCGTCAACGACGCCGCCGCCGCCTTAAGTCGGATCCGAACTTCGTTCCAATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGC
CCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGCTGTCACATCTTCGATGACGAGACCGCTTTACCCGTCATGAAGAGGATAAAGCTGCCGAAGTTGCTG
GTACGGGTGATCAGGATGCGAATAATCAAAGAACGCTTGGAGACCCTCCAACGTTGTACGCACGGTCACCTCACCAGCTGGTTCAGGAAGCGTTAAGCTC
AAGAGTCGCTCGAAACACTTCTTGGCGCCTGCATCGGTAAACTCCATGTCCACATACGGAAGAACCCACGGTGGCAGGGTGGACGAAGCCGGCACCGTAG
GGCGAGTACCAGATAACACTCGGTGAGGCAACGGCTCAACCGACGGTGCACCACCACGACGCGGCACCGAGGTATAGGTTGCCGTAATCATGCGTCCAGG
TCCAGCATCGAGAGTCCAAATAGACGGACGAGGAGACACTGGAACAGGAAGAGAAGATGCTGGTGCCGGAGGACTTGCTGGTGGCGAAGGAGGCGGGCCG
GCAACGATGATTGGGA