Description :
From Genome Similarity Track
Location :
Scaffold_532:4265- 8954
Sequence
4689 bases(100 bases per row)
TGAACTGCACTTCTTCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCCCCAAAATGCTGATGGTCCTCCTAATTATGAACAACTTGAACTCGCATTGGAGATGGCTT
ACGACCATCGCCAAGGTCGGAAAGCAGAGGGCGCCAAGGACAATGATGATGAAGAAAAGGCGTTCGTTGCTGGTGGAGGAAGAGGTCGAGGACGTGGTCG
CGGCCGTGGACGTGGTGGTCGATCTGGAGGACACGGGCGTGGTTCCGGTGGTGGACGTGGTTCTGGTGGTCGCGGGAGCCAAGGTGGTGGACGTGGAGCT
GGACGTGGCCAAGCCGGCAGTGGACAAAAGCCAGGTGGTGCTTGTTATCACTGCCATGAAGCAGGGCATCATGTGTTTGATTGCCCTTTTTTGGCAAGTG
ACCTCCAGCCGAGGATCGCAGCAGCACCCAAGCTCAGAAGCGCGTGAAGATGTGTGGAGGAAAGAGTGCTAAGGCTGCTGAAACGAGTAGCTACGCTAAT
GAAAGTGATGACAGTTATTCTTCAAGTGATGAAAATGAAAAAGCCGGTCGCAGACAAAGCCCATGATAACTGGTACCTGGACTCTGGTGCATCGAGTCAT
ATTTCGAACCAGCTCACTGATTTCATGGAGTTCACGCCTCTTAGCGCCCGGATTCGAGTTGGAGGAAAGAACTCGCTGGGTGTTGAGGGTAGAGGTACTG
TGGTTAAGGAACTCGAGACTACTGGTGGGAGGTGCTCACTGACGCTGCGAGGAGTTCGTTATGCTCCAGAGCTGCAGTGCAGTCTCTACTCTGTGCGACG
GCAACTGAACCAATATCTGCCTGAACGTGATCGTGTGAACGTGCACTTTGATGAGGCAGATCGCGCTGATGTTATCTTACAGGCTGGTGTGACTACCGCT
CGAGTTGATTATACCAATCTCTATCGCTTGAAGTTGGAGAGACCCCAAGAGGTAGCCATGGTGGCGCTACCAGCTCGAGTGAGTAGTTTGGAGCTGTGGC
ATTCGAGATTGGGGCACCCTGGCAGATACTCGTTTAATGCGCTGTTCTGCCATGATCAGTGGCCGTTGCCACATATGAACTTGCGTATCCCGGTGGGTTT
CAATTGCGAGACCTGTGGGACGGGGAAACTTACGAGGAAGAGCATGAAGAAGTCTCGGACACAGACCCGCGAGTGGTTAGTTGGCGCAAAGGTCCATGTG
GACGCTTGGGGTCCGTATGTAGAGCACTCCTACGGTGGTAAACGGTACTTTGCCGTGTTCGTTGATGATGCGAGTCGGTTTGTCACCGTGTATCTTCTGG
AGCATCGTTCGGAAGTGTACCAGAAGTTTGAGGAGTACTATCAACGCGTCAAGACGTAGCAGCATGTCAGAATGAAAGCGCTAAGGTCAGACAATGCAAA
GGAGTTCAAGAAGCTGCAAAGTACGTGTGAGACGAAGTATGGTATGGAGTTTGACAGCAGCATCAAGCATACTCCGGAGCAAAATGGTGTCGCGGGGAGA
ATGGTCCGCACCATTACGGAAAGAATGCGATGCATGCTCGTGCACTTCGACCTGCCTGAAGCGATGTGGGGTGAGGCAGCGATGACAGCTGCATACTCCG
TGAATATTATGCCAAGCTCGGTTCGAGGCATGGAGGTACCGTATGCAGTATGGCACCGTCAGACTCCTGCTTATGAGAAGTTGCGGACGTTCGGCTGCGC
CGTCCTGTCGTACATCGACAAGGTGGAGAGACGGAAGATGCAGGCGAAAGCATGGGAGGCGGTCTTCGTTGGATATTCGCGAGAGAAGCGAGGCTATCGC
TTGCTCGATAGCAAGACCAACAAGGCCTTCTACAGCCATACTGTCGTGTTCTATGAGAATAAAGCTGGTCGATTGCTCATGGACTCGGCATCAACGCCAA
GTGCAGCCTCCGGTAAGGAATATTTAGGCGTTGATCGATCAGTAGAGGATGACATTGAGCCAATGCTGGATGAAATGCATGATGAATCAAATGATGGAGG
TAGTTATCGTGATGATGGAGATTGCTGGACTGGTGGGGCCAGCGACTCCAGAGACGGAGGTGATTATCGGACTGGTGGGGCTGATGACACCCGATGTGAT
GACCGACCAGGTGGGGCGGTTGAGCAAGATGTCCGGTCAGGTGGGGCATGTGGGTCCAAGAAGAGAGGCCCCGGTGGTGATGCCGCAGCGCCTCGACCAA
AGAGAGTGCGGTTTGCGGTGTTTGAAAGTGGACGTTCTAGCAAGGTGGCAGAACGAGATGAAGGACGTGGAGTGAGCTCTACAGCATCTGGATGTGATCG
TTCTAGCAAGGTGGCAGAACGTGATGAGGAACGTGTCAATGGACATGAGGCAGACCACCTGCGAGCTGAGTGCGTGCCAGACAATTCCAAAAGAAGGAGA
AAGAGGAAATGCAGCAGTGGGCGGCATAAGAGACCGGCTGCTGACGAGACGAGGGCCCACCAGGGAGTCAAGAGGTGGAAGAGGTGGACAGCAGGTCATC
GGCTGCTGAGCGGGCCGACTCGAACAGCCAAGTGTCGAGTGATGCTGCGAGTGTGGGGCGTCTATCAACGCCTCCTTGCACAGTACTTCGTGAGTACACA
GGCCCGAGAGGCACTCGCCCTAAAGACCCTCCAGTGACACGGAGCGGTCGGGTAAGTAAACCGCCCACGTGGTTCGGTGACTACGACTACATTGGCTACG
AAAATACAAATCCAGATGATGATGTGAACTCGTTGCCTGCTGGATGGAGGAAAGCACGAGCTGAGTTGCAACGTGCTATGGCGAACGAGTTGATCTTTGC
ATGGTGGGAGGACTGTTGCTGCATGAGTACTGGCGAGTTTGAAGAGCCAGATACTTTCGGTGACGCTATGGAGAGTGAGCACTCATTGCAATGGAAAAAT
GCAGCTGATGATGAGTTTGATTCGTTGGTGAAGAACGATACCTGGGAGTTGGTGCCGCGTGAGAAGCACATGAAAGTGCTGCAGAATCGCTGGATCTTTC
GCGTCAAGTATCTAGCGAACGGAGAGATCGAAAGATTCAAAGCGAGGCTCGTGATCAAGGGCTTCATGCAGATTTATGGTATCGACTACCTAGAGGTGTA
CTCACCTGTTGTGAGGCTGGAGACACTGCGTGTTCTCTTGACACTGGCGGCTGTCTGGGATTATGAAGTGCATCAGATGGATGTCACTACCGCTTTCCTG
AATGGGGCGATTGACGTGGAGGTCTATATGGAGCAGCCTGAAGGCTACAAAGTGAAAGGCAAAGAGGACTGGGTGTGCAGATTGAAGAAGAGCCTGAACG
GCTTGAAGCAGGCGCCCAGAGTGTGGTTTCAGCTGTTCAAGTCGTTCTTGGAGGAGCAGGGCTTCACGATGCTGCAGTCGGAGGCCTGCGTGGCTGTTAA
AGTAATTGATGGGCAGTTGGTCTTCATCCCTCTCTATGTTGATGATCTGATTTTGTTTGCTCCGTCGATGGAGCTCATCAACAAGATGAAGAAGATGTTC
GAGGACCGGTTTGCGATGAAGGATCTCAGGGAGTTACACTACATTCTAGGCTGGGAGATCACGCGGAACCGGCCCGAGAGAACGATGTTCATTGGTCAGC
AGAAGTATGCCGAGACCGTGCTCAAGCGGTTCAACATGCAGGACTGCAATGGCTGCAAGACGCCGAGCACGGCGGATCTGAAGCTGAGCAAGGCCATGTG
TCCGACCGAAAACGACGAAAGGCAACTGATGAGATCGAAGCCATATCGTGCTGTGGTTGACAGCCTGATGTACCTGATGCTCGGTACCCGGCCCGATCTG
GCCTACCTAGTTAGAGAGTGCAGTCAGTTCTCGGAAAACTCAGGTCTGTTGCATTGGAGAGCTGCAAAACGTGGATTGCGCTACCTGAA