Description :
From Genome Similarity Track
Location :
scaffold_10:426482- 427777
Sequence
1295 bases(100 bases per row)
CTTTACTGCCGTACTCGATGAggtatgatctgtatagatcgcaaagcgcTTCTCTCCAAGCAAGTACACACGGAGCTTTACccaagcatacttcattgct
agTAGATCTTTGTCATGGATTGGATAGTTTTTTTCTGGGGGGTGGAGTTGTCGCGACTGATACGAAACAACTCGCTCTCGACcctcatcatcgtgttgca
tgATCACTTGCGTCGCTGACCATATGAATAACGTTTATCGTGGTTTACAATCGCAAATAGGAGCCTTTCTGAAGCTCTTCATCTTTTTGGCAAATACCGC
CTGGAGATCCATTGACCATTCAAACTCAACGCTTGTCTTTGAAAAAGTCAGTAAGTGTTGCACCAACGCTGCATAATTGTATGTGTTTTTGTGCAATTAG
TCGGCCAATCCAACAATCATCTCAGCTTTCCATATTGTTTGGCACACAGGCCAATCATTGATAGCTTTGACTCTCTCCAGATCTACACGAACGCCAATCT
TGCCCACAAAGCAGCCGAGAACGGGGATCTCGgtgcaaagaaaatgcacATTTACAAATAATCGTACAGGTTATTCTCTCAAATAACTTGgaagatgatc
aagatgaacatcgacATCAGACTTCTCACCCGTTTTCTTCCTATAAACGAATATTTTGTCAAGTTAACTCATTGCGAACTATCTCAGTGTTCCAGGAAGA
TTCGTTACCATTCTGTTGAAAGTCGCGGGATcgccttggggcatcactaaCCATTCCAACTGCATATCACTGATGGTACTGACTGCAATAAGTGGTGCAT
CATTTTCGCGCATTCTTATCTGATAGAAACCACCTTTCTGATCGATCGCACTGAGAATAGTACTGCCAACCAATCCATCAAGAGTTCTATCCTTGCGTGG
AATCGATGTCTGGGCAGGTATGGTCGCATCGTATAATTTGTTAAAAGCGCGAGCAATGCGCCAGCTACCTGTGTTTTTTCACACAGTAGGTTGGACTACA
ATGCGAAGACTTACGCTCACGCACATGACCAGCCTTCTGTTGCTGCgcaaagatgtcgtcaattgCAACGACTTGTTCTTTTGGCAACGGCTACTGCTGT
GTGATACAAAACTTCGTACCAGGAAgtatgtcaatctcatgacgaatgCCTCTGTCAGATGGTGATTCGTCCGGCATCTTGCCTGGAACATGTCAGCATA
TTACTTGATAAATCCATACACGCGGTTTGAGCTAGGGAGGTCCCACGACCGCTCATCAAAGCTTTCCTTCCGTGGCTGCTCATCGCAGAGCGCTC