Description :
From Genome Similarity Track
Location :
scaffold_38:426471- 428675
Transcript NameFunction/comments
Plaha_PHALS_04820rna-dependent rna polymerase1

Sequence
2204 bases(100 bases per row)
TAAACAACCAAATAAACCCTGTGGGTGAGAACATATCCAATCCTCCCCCCGACCGTCGTCGGATCAATCCTACACACTTTCCCCACCGCACCAAAAAATA
CACACAAGGCCAGAAAAAACTGTACGTTTCCATGTATGTCCGGAAGAGGCGAGTTTTTACGGGCCCACTTGAATATTTACACATGTCTACCGACCATTGT
TGTAACGAAAACGATAAGAGAGGCACTCGAATACCGTCTTTAAGGTTGACGTTGCTGTGTGACTTTTCTAAAGCCGCGGCGATAGCCTTCAATGAGCCAC
GTGGAGAAGAACAGCACACCATTACATCCAAATCGGACTGCTTCTCAAATGTGAGTAATCCAGAGGAACCAAACAGAATTAGATCAAACTCCTTCTTGTG
AAGGTTATCAGGCATCTCCCCGCATAACGAACTTACTGCTACCAGTCGATCGAACAAGTCCGCAAGCAGCTCTTCCGTATTGGTCGCAATTTCGGCCAGC
ATACACAATTGAAGCTTTGGAATCGTTTGAGCATATGCCGACAGACGTACTGGTGTCCATAGCTTATAATGTGCTTTGTCAGCATTGCTGCTCTTGATTG
TGATGAGTAAATCGATCACAATCCACGGAAAGCTTACAGAGCGCGTTGATGCGTCGGAGTCATCTTGAGAGACAAAATAGCAGGCAGCTGCAAGTTTCAA
ATTTTCACCGGGCGCGAAATTGATGGTGTCTTTATCAAATTGGGATCGGAAAGAGGCTTGAAGAGTATAGAAAGCGTCCTTGCATTGTTCGCCAAAGCGA
AAATAATTGGCCTTGTATTCGCTTTGAGGCTCCACAATCATGCCCGTTGCGAGCTCCGCTTCAGTTTGGGCTCCTGACATCACCAACAAAGCTCTAAGGC
GCAGCTTGTACTGGCGGTAAAGCATTTTGGCATGACCCAAGTAATCCGTGTACCCATTTGTTAACAAGTGATCGTCACGGATCGGCATTTGGCTCACACT
TTTCGTCATTGTCGTGTCAAAAATTGCTTTGCAACGTCGGTATATCTTGCCCAGAACTTTTCTTGACGGATATGACGGTTTGTCCTTGTTCTGCATAAAA
TCTGGATAACTTTTGGGTGCTAGATTTCGCACAATTTCCAAGTCCAACTCTGCGCGAAGGCTGTCAACCTGCTTAGAGCAGACACGCGCTAAGATCATCG
CCTTGTCGTCAAAACTTCCATCAATTGACGAATCACATAGAGCAAGGTGGGCATTTGACGCTACACCCAGAATATCATCCTGGATGGAGTGAACATAAAA
ATCAATCAAGCCAGCGTCATCAGTTGATTGGTGGTATTCGCCGCTGTCCCCTTCATCGTCTTCGTCATATACCATCGGCTCCTGAACTTGCGTTTTAGAT
GGAATCAATCGCTCGTCCCAGATGACAACAAACATGTCACCATCCAAGTCTCCGCCTGTACACTCGTCAGGATGAGGCCGTGGACCTTTACAAGGAAACA
CGACACAGTCCCTGAGCTGGCGTAATTGAGAGGGTACATCTGCTCTGCAATGAAGCACTCGAATATCGCCAGGATGGTGGCAAGGGCTACGATGAACAGC
AACATCGACTCCATCAAGCAAAGTGTAATAGCTGGAACCAGTCTCCTGATCCTTCTCTGAATACTGCACGAAAACTTCTCCGTACTCCAAAGTGCCGGTA
AAATCCGCCACTCCCATTAAAGTGCGCCCTTTTGCGATAGGGATTCTAGCGCGCATCACAGTGTTAGCAAGTCGATAGTGATATATTGCTCTAGCCAGCG
ACGACAAATATTCATCAGCTAAAATTTTCACCTCAAACGTACGGACAAGCACATCAATCCACCAAACGACTGTCGGAGGCAACACGGCCTTCAATCCAAA
GTATGCTCCATCATTAAATGCGATTATGGAACGGAGCTCGCTTAAATATTCTTCCTGCATTTCCATAAATACATCTTCATTAATTCCGAGATCATTTAGA
ATCAGGACACTTTGACGTGTCAGGTATGCCTCCGATTTGCCCGAGCACGCAACTATTTCAATCATAGTGTGATTTGACGTAAACTTACACATGCTTCTTC
GAAGCACAACAGAGTTCTCGCGGCTAATATCGTCTCCTAGATCAGATACCACAAGAACACCTTTCGCTCCTCCGAGACGAATTTGAAAGGCTGACGGAGT
ATAT