Description :
From Genome Similarity Track
Location :
scaffold_127:4264- 5389
Transcript NameFunction/comments
g4163.t1 hypothetical protein PHYSODRAFT_471256

Sequence
1125 bases(100 bases per row)
TCCAGAACTGAATCTCGTGGTCGAGGTTGGAATTGTCCGTCGCGCCACTGAAGATCGGACGCATGTACAACGTGTCCGTCTTGACCGTTTTCTCGTCGAC
GACCGTAGTACGCACACAGGTGCCTTGTTGCCACAGCGAAAGACTCATTTTGCCCCATTTGTGCTTCTCACCCGGTGCGATGTTCACGTATCCGTTGTTC
ACCAGGTTGTCGTTGATTCCTTGAGCCACAGCGATGCCGAACCCAGAAACGGCTCCAGTGACGGATGCCACAGTGCCAATTGTACCTGCTGCTACGGTCG
CAGCGGTGACTAAGGCACTAGTGGATACCCCGAAGACGGAGACGACTCCGTTAGCCACAAGAGCAGAGGCAATTGGTGCTGCAGCTCCAGCAGTTCCGAT
CACCGTTGCAGCAGCTCCAACGACAGAGATGATGATACCAGCGATCTTGAGAGCAGCTTCATCCGGTCCAAGCTTGCAGGTCCATGGGTCTTTGGTGTTG
TTGACGATGGAGAGGTAGGAACCCATGGTTGGACGTTGGGAAGGTGATGTCTTGCGGGATATGAGGCAAGTTGGAGAATGAATTAATTTAAAAGACTATT
TATCTCCACGGATAGCTGAGGAAGGACGACAAACAGCGAAGAAGAGCGTCCAGCAGACACGTTGAGGGCTTCCTCGAGCACGACTCTAGTCAATTGATGC
GGCGATCCACAAGCAGAGGAAGTGGAATTGTTGCCAACGCGTTCCAGACGGGATTTGTGTTGATGCATTGCAGTGTTGCCTCAACGCTTGATGCTCGATT
CCCAATGAATAGACTGCGCTACGGCACTGGGACTTTACGAAGAACCATTTCCGAGGTTTGGGCTTGAGCTGGACCTGCAAACGGAAAACATTTTGCCTGA
AATGGTTCAACAGACCATGTACACAAACCTTTTGCTCGGACCAGTTCCATTTCGTTACAGGAATTCTGCCAGGAAAAGAAACTTACCTTATGTCAGTCTA
ATATTGAAGTCTCCATCGTGTCAATGTCATTGACTCAATGGACAGGCAAGACGAAGTGTGGGGCAAGATATCCTTTCTGAAGTGCAAATCTTGACTGAAA
ATGTCCGTCATGCCTTTCTCTGGTC