Description :
From Genome Similarity Track
Location :
Scaffold_6:426388- 430303
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_02483protochlorophyllide reductase
Sappa_CBS223.65SPRG_02484phosphoesterase
Sappa_CBS223.65SPRG_02485Hypothetical protein

Sequence
3915 bases(100 bases per row)
CTACACAAGCGGCTGCGGGCGCGGGGCGTCAACCACGTCTACGTTAACGCGCTGCACCCGGGCATCGTACAAACCGAGCTCTTCCGCGAGTATTCCTGGA
TCGTGCAAAAAATCATTTGGTGCTTTCAGCGCACGGCCGACGACGGAGCCAAAACTCAAATCTACTGCGCGACGAGCCCCGAGATTGAGAAGAAGAACCT
CTCGGCCAAGTACTTTACGCCGATCGCGAAACTCAACGAAACGACCGCGCTCGGCCAAAATATGGAGCTTGCCGCCAAGCTCTGGACCTTTACGGAGGAG
CTCATTGCATCCAAGACACCATCTACGTAGACGGGGTACCACGTCGACTCTGTGTACGCCGTGTGAAAACAATAATGATGCACGAATGATGTCCAATGCG
ATATAGTAATAATCAGAAGACACTATCGTTAATCCGTCGACGCAGGACGCTTCGAGTACAGTAGAAAGGCGCTGCGCTTGCTTCGCACGCACGTGTACTT
TGTTTTCGATGCACACATTGTCGTACGAGATTGAACACAATTCCACGCTGTCGATACAAAAGCTATAGAAAAAAATCCTGCAACCGAGCCAGATCGGCGG
TGGCAATGATAAGTCGACCCCACCGTTGCTTTGACAGCCATGTCCATTAGTTGTGGGCATGCGTCCAGGCACAACGCTGAGTTTCGCCGATCTGTTCGAC
TCGATGCGTCGACAGGACGCCATCCATTCGCATGTAGCCGACTTGTGACTTTAATTCGCCACGTCAATTGGCCCAAGCGCCGCACAAGGCTACCAATGCA
TTGGGCCAACCTACCAACCTTGTATTGGTACCTCGCACACGGTTAAAACCAAACGACCTCCGTAATTGATTCGTGAAGTTATTACATAGCTATCAACCGA
AGCGTCTCCAAGTAGCGAGACACCTTTCTGTGGCCGTGACGTCTCGCCGCGTCTTGCACACGTGGCGTCCACCTGACGCCGGAGGTGTCGTGCAAATGCC
GGACCATCTCGAAATGCCCCCTCGCCGCCGCGCACACCATCATGCGCTCCGCGGCAATCGGTGGCAGCAAATGGAGTTGGAACGCATCGCAAACGAGATG
CAAGATGTCCAGGCTTCCACTGCGTGCAGTCTCTGAAAGCAGCGCCATCAGATCGCATGTGTGCTCGTCTGCGCATGTGCACGTTTGCCACAAGCCATGC
GACAAGACGTAGGCGACCACGTCGACATGGCGCTTCCGAACAGCAGATAACGTGGGTTGGTGGCCGGTAGGACGCTGGCCGAAACCCTCGTGGAGGTAGC
GCACGATGCGTAAATGACCATCCGCCACGGCTTGATTGATTGCATTTGACGGTAGGGCATGGCCGCGGGCAACAAGCAGCTCCAGGATTTCGAGGTGGCC
TTGGCTCGCTGCCCAGTACGTCGGCGACCCCGTGACGTAGTCGCCACTTGGAGTGCCAAGGTCATCTTGCCGAGGCAACGGCAACGTGCAGCGCCGATCC
GGGCATACCCTGGCGTCGCCCTGGAGTCCCGAGTCACCCGTCGGCACGTCCAAGAGGTACGTCACCATCGCCATGTGGCCAATGTAGGCTGCCGTCGCCA
AGGCGGCGTGGGTTCGACACAGCCCGTAGACTTCGTGGAGCCAGCGCACAGCGTCAAAGTGACCGCGGGCTGCAGCAAGCGCCATGGCGTCTTCGCCACA
CCCATCGCGTCGGTTCTTGTGCAGCCAGTCGAGCACGTTCAAGTGACCACCGTAGGCGGCAAAGACGATAGCTTGCTCCGACCCGACGCGAAGGCGGCTC
GCGTGCAAGAGCTCCAGCGACGTCATATCGCCGTTCAAGGCCGCGAGCTCCATCACGTTGCAGTGCTCCCAATGGCCGAATGGACTCGGGTCGTTAACCA
TTCGACTGAATGAGAAGGTCTTGTCTGGCGTGTCCGTTGGCAGCCACTCATCGTCGCTGGGTTGTCGCGGGTGCTCTTGATCGATACAGGCGAGGATATA
CCGCAGCATTTCGTGGTCTTGCTTGGCGACTGCTAGCTCCAGCAATTGCTTGGTCATTCGCTTGAGGTACCCACGCGCGTAGACATGTCGAAGGACTGCG
AGACCACCCTTGTCCACGATCATATTGAAAGCGTGGTCCGTCAACTCGACAGTCGCTGCGACGAGATCGACGGCCTCAATGTGCGTCTCGCCGCGTACAC
TGTGCGTCTTGAGCTCGTGATGTGGTCGTTTAAATTGAAGCGACGGGTCAACGCCTTCGGTGCGCTGCTCGAGAAGAAAGTGAACGATCGACGCGTGACC
GTGGACGGTTGCTGCCGTTGCCGCCGTGATCGTGCAGCCCTCGGTCCGTGCAGAGTGCAAAAAATGGACGATGTCATAGTGACCGTTCATGGCTGCGCCG
TCCATCGCGTCAGTGGTGCACGCAGCACCCGCCTCGTGAAGCCACACGAGCAGCGGGAGGTCGCCCGACATGGCGACAAGGTCCATCATCTTGGGCGTGG
CCAGCGCAGGAAACTGCTCGAAAAGAAGACGCAGAATCGGACCTTGGGACGCGGCAGCAGCAAGCTCCAGCGTCGCCGAGGTACACAGCGAGGCATCCCA
TCGCAGCCAACGCTGGACGAGCGCCACGTCACCTTCGACGATCGTTAGATGGAGCGCGAGGGCTCGGTCGTAGACGCTCGGCGAGACAAAGAGCGCGTGA
TGAGGTAGCTTGGTCATCGGGTGTGCGTAGCGCTGGAGGTACGGCAAGAATGCAAACCGAGCTGGGACGTGGGCGAGGTATGCGCCTGGAAGGTCCTGGA
TGGAGAACCTTGTGAGGTTGACGGCATCGGCGAAGCGCTGGACGACGGTCAAGTCTTCGGGTAGTCCTTCTTGATATGCGACAATGATCGCAACGAGGTC
GGGCGACCGGAGCACGGGCGACGCCAAGCAGGTGTCCTGCCCACGGGCGTTATTGGGTCGCACCGGTAGTCGCACGTTGGACAACATCTTTCAGAGTGAT
GGTACCGTACGTTGCAAGCAGGTACATTGCAGTACGTACAATGAAGTACGAACATTATTGCACTGTAATGTACGCGTCATATGGAACCGATCGAAACGAT
GCTTGCAGAAAGGCTGGACCGTCGAGCTAATAACTCGCTGGATGCTACTGGGAGACTTGTTGGTATGTCCAACGGAGCAATATATCTCAACCATCCAGGT
ATTGATAGACTACGTAAGTGCCCGCCAGCCATGTTGGGGGTGGCTTGGCAGGAATCGCTTATACTGCTAAGTATGAGGCTGAAACGCGAAGTGGCCACGC
AGCCAGGGCTATGGTGATGAGACTACGAATCTTCTATCGATCGACTCGAATTCTCAAGGTCCTTCGCTTGCACGACCCTCTCTTTGCGCCAGAAATTATC
AATTGATTGCAACCGTACACCAACTCTGTCTCGTCTGCTCTTGGTACACGCGAGTTTCGGAAGTCAGGGCCAGTAGACGAACGGCACAAGTCGCTTGGAT
ACCGAATCGTGTTGCCCTTGAAAAAATCAAGTACGATGTACTAGTATGCGTTATTAAAGACGTGGTGATGACTGGCTGTACATGTGTCTAGAAGTACGTG
TACGTCCACTGCTGCGACGCAAGGCCTTGATTGCCATGGGGCGTCGCCAGTGCAAATGTCGACTCAGAGTCGGAAGGTGCCGTCTGGGCGCTGGGCTGGC
AGCCTTCGCAGCGGCTGAGGTACCCACCGGTGTAGGCGTTCTGGAGCGTGATCTTCTTGTCGCCAATCTCGCGGCACGTCCACTCGGTCACGTTCGACTG
TGTTGAGAGGTCGTATGCGAACACGACTTGGTTCGGGTCGATGACGCCGGGCGCTCGGTTCAAGCTCGGCCCGATGCTCTTCGTCAAAATGTTGTTGGAC
CGGATCGTGTACCGG