Description :
From Genome Similarity Track
Location :
Scaffold_72:42637- 45557
Transcript NameFunction/comments
Phyta_totarag2905hypothetical protein PHYSODRAFT_500307

Sequence
2920 bases(100 bases per row)
GATACAGCGTCGGAAACTCCAGCACGGTCTTCTTTGGCAGATCCTTGTCGTACGCCGAGAAAATGACAATCGGGAGAGCCGTGAAGATAAGGTTGTAGCC
CTGCTGGATCAATGCCGTGTAAATCATAGTGCCAGAGTATGCCGTAGGCCACAGAGTGTACCAGAACATGGACACATTGTACACAATATTCTTGTAGAAC
GTGTACACGACGAGTGCCGCAACGCGGTTGTAGTTCCAGCGACCATGAACCAAAATCAAGTTGTTCAGGAATCGGAACTGACCCAGCGCGTAGTCCGAAC
TGTTCACAGCTTGTAAACCCTCTTGCCCGCTGATACCGACACCGATGTGAGCACTCTGTATCATCGGAACGTCGTTAGCGCCATCGCCAATTGAGAGCGT
GTGCGACTCCGGAACATTAAGCTTCACTAactcgaccagctgcgcCTTCTGCTGAGGCGACACACGACAAGCGACCACAACCTTGCACAGCAATGACACA
CGCAGAAGATGCAAGTTGTGTAGCGGGTCTTCCAAGATCTTATTCAGCGACGCTCCGTCAATAACCAGCGCGTGCTCTACTTGGCCAGATGGTGGTGACA
AGACAGAATGGGCAGCAACAGTTGATGTGTGCGAAGCATCATCATTAGCGTCGTGAATGGAGCGGAAAATCTTGTCAAGCTTTCGTAGAATCGAGCCCTT
CGTCCGATACTTTGCCGCATTGATCACGTGTCGCTTCATGTCATTGTTAAGCAAGCGGCAAGCATAGCCAATGTTGATCGCCGTCTCCTCCATGTCTCCC
GTCAGCACCCAAATGCAAATTCCAGCCTTGGCTAGGGACTCCATTGTTTCAGGTACACCGTCCTGTAAACGATCTTCAATAGCAGTAGCaccgagcagct
ccaagtttGACTCCATCTGATCCTGAAGCTTGTCAATACCGTTGGGTTCGCCCCGTGACTTCGTCTCAACTTCACTCAGATCAGCAGACACGTGACGATA
CTGTGAGTTAAACTGTTCCCAAACTTGAGGATTGATCCTTTTCGCACAGACAACCAGCGTTCGGAGTCCATCCTGCGCGAAAGCTTCCAGATGCTTTTCA
GTTAGTTCACGGATCTGTTCGTTGTTTGCAGACATCGGAGCCAGGCGGGGAAAGAGCATGCTGTCAGCTCCTTTAgtgagaagcagcacgtcatcCTCCT
CGCTTTCAGACATTAAGCGGAGTTCATCGTCGCGTTTCCGACGCTGCACTATGACCGACATCCGCTTTCGGTTCGAGTCAAACTCGAAGACTTCCAGGAT
ATCATACTGATCCACGACACCATCGGGCTTCTTAATAGAGACACTTCCAGGTTCGCGGTCGATGAACTCGTAGCCAAAGTACTTGGCACCACAGACAAGG
GCGAGCTCATCCGGGGAGGAAGCTGAGTAGTGAACAGGAGGACTAGAATCATCTTCCGTTGGGTCAAGACGCTCAATCAGGACACCATGGCACAACGCTA
GCAGAGTCACAAACTCTTCGATCTTTCCGCTTTGAGGGCCATCTTTGCTCTGCATATCTCGCCACATGGTCTTGTCCTTAAAATTCACGTTGGGGGCCGG
GGCATCCATGCGTGCATCCAAAAGCGGGATATCGTTCTCACCTGCGGATTCTTCGTCCACGGTTCGATCTCCCTTGAAATCACTTCGCATGCGCGCAGCA
ATACCAATAGCCGTCGTTCCCTTGCCGTAGCTCCGGCCACCGATGCTACACTTACGGAATTCCATCTTGTTGCACGTGAGGGTGCCCGTCTTGTCCGAGA
AAATGTGCGAAATCTGACCCAACTGCTCGTTAAGCTGCATGTTGCGAACTTTCACCGGGGTGACAGTTTCTTCATCATACATGTCAAGATCGCATTCCAT
GAAATAGCCTTGCAGAGCCTTCACAAGCGTGATGGACACATAGAGCGTAATTGGAACCATTGAGGCGAGCGTCGTGAAAAAGTACACAAAcgtctcgatg
aagctgtCATCCCAGCCGTCCAGTTGCAAATACGCCGGAATGACAATGCCATTCATCCATATTCGGTCTCCAATGGCACCAACAAGCGACATAAGCAGGA
GGATGACGACCACAACAATCACTTGCTTGTTGGTCATCTCGTCAATGGACGAAACCTTCACCGGGAATTCGTCGCCGGAGCTCATCATAATCTTGCTGTC
GACACCAGTGTTCACCACCAGCCCATAAACGTAACTGGTGTTGCGCAGCTTACTGCCTCGAAGCAGCATATTCTTCAACGCAAGAGGGACCCCCTCAGCG
TTCGCCCCATTCGGATTCTCTTCCAGATACATCGTACCCGAGTACGTGTTGATATCACCGTTCGGGAGCTCACTCTCGACGTATCCTTGAATGATGTACC
CggcttcttcctcgttcATGAACATATTCCGGGTAGGCGAAGGTGCTTCTCGCAATTTGAGGTTTGTCTCGCCGTCGAGATTCTTCGTTTCGACGTAGCA
GAGGCCCATGTTCCCGCCGGAGCGCGCTCCTTCCGCGGGGATCACAGCCATGATCATGATATCTGCTGGCAAAATCTCGCGATTGGCGACCTTGACGAAG
TCGCCCACTTTCAGCTCACGCCACTCCACTTCCTCGAACTCGCGCAGTTGGCGATTAAATACCTGCGTCTTGGCCGAGTTGGCGAGGTCGTCCGCCATGT
GTCGCTTGTAGTCTTCGTAGCCGGCGAAGATGGCATCAATGACGATCACGATAGCAAGGGGGATAAACTGTAGCGGCACCCCGTCCGTCGGAGACACCGA
CGGGACGATCTGGAAAATGCCAATGAGCAAGAAGTACAGATTGGCCGTCTTCTGGAAAGTTAGGTACAGGAACACGGGCAcgaagctccaccacgtgtAC
TGCGACGTCGTGACCTCGTT