Description :
From Genome Similarity Track
Location :
Scaffold_38:426338- 427641
Sequence
1303 bases(100 bases per row)
ACGAAGAGAAGGTCACGCCGGACGCTGGAGCGCTCGCGGCTCTCATCACTAAGCTCACGGCCAAAGTGGACAGCTTAAAGCGGTCGCTGGAGACGCACCA
GCAGCGTGCGGCCGTCACGCCACCCGGTGCGGGGGCTAGGCTGGGCCAGAGCGTGTACCGTCAGGCACCGCAGCACAGAGGCAGCTTGGGCATGCAGCGC
ATGCAAATGCATGAGCTCGGCGCGTCGAACTTCGGCATGGGTGCGCAGACGCCTGGGGGTGTATGGTGGTCTTGGTGCTGGGCAACAAGCAGGAGGCACA
CCGTTCCAGGCCCAAGAAGCAGCTCAACAGGCGCCACAGCAACAGTAACCAGCTGCGCAGTACCAAGCACATCGACCTTCACCGCTACATCTCAACGCGG
GAGTGCCGCCTGCCAAGGATGCGAAGCTCTTCATGCGAAACTTCGACGGCAGCGAGGTCTACAAGGGACTTGGGAGCGGCTTCGAGCAGTGGGCGCTGCT
GTTCATTGAGCAGATCGAGATGGCGGAGCAGGCGTGTGGCTACGCCTGGCCTGAGCGCTACAAGGTGAACAAGTTCGGCCAGCCTATTCTTCCAGCAGCA
CATCATGCGCCGGTGGGCCACGCAGCCGACGCACTGGTTTGTGATGGATCAGATGCACTTGTCGTTCAAGCGGGCGCTCTCGACGCAACAAGGAATGAAG
CTCTTTGGCGCGAAGAAGGACCCGTCGCGATCGTGGAATGAACACTTCTTGTACTTGAATGCTCTCATGATGGCAACGAACGCGTCACCAACGCTAGTGC
TGGAGAACATTGTCAAGGACGCGGATCCGGACTTGAGACACGCCTTGATGGCCAAGTGTGACATCACGCGGCCGGATCCTCTCCAACAAGCGAACGAACT
GGTCGTTTGGGCGCAGATGATGACCGATGAAGATCGAGCGCCAAAGCATCTTGGTAAGGAAGTCGTGAACGCAGTTGCTGAGTCCCAAGAGGAAACGCGG
CGATACCACAAGTGCAAGAAGGCTGGACACCTGAAGAAGAACTGTCCAGATCGTTCCGCTAGAAGCAACAATGACCAGCCAGTAAAGTTCGCACTTGCCG
CCGGTAACGACCTCAAGTACGTGGACGCTACGAGCAGGATTCTGGACAGCGGTGCCAGCCGACATCTTGTCAACGTTCCTGCGCTACTGGCTAACATAGT
GCAGTACTCTGGTGAGGACACCTGCATGTTACCGGATGGGCGAGCGATGGACGTAGCCAAGAAAGGATCGGTGGTTTTGAGAGCTATTGTCGACGGAGTC
ACG