Description :
From Genome Similarity Track
Location :
Scaffold_375:42633- 46962
Sequence
4329 bases(100 bases per row)
CGCCGCTGTCGGAGGAAGTGTAGCAGACTGAGGGACGTTCGAACGCTCGGCCTTGCCCTCCTGAGAAACAAGTCGAGTAATGCGAGATGATGAGCAAGGT
GCCGATGATTCAAGAGAAGGATGAGCTGACGTACCTCCAGCTGTTCACGTTCGCGACGTCTACGAGGATTGAGACGCTGAAAAGCGTCGGACACGGCTCG
ATTCAGACGCTTGGACATACGGTGGCGAGATGATGAATTGAAGAATGAAGAAATGTCACAACGGGCACCAGTACCGTGGCCTCCATTGCGACAGGGGCAG
TTGTGGTGTAGTGATTTCTCCGTGGTTGCGGATTATCACCCGTCGACAAAGACGTGACACCGCCCTAGTTGTTCAAGCGACGAACCCTCGGTCGGGTGAT
GTACGGAGACGCCAAGGTGCAAGGGACTCGACGGCGTCACCTCCGAGTTTTCAACAAGTATCGGATACGGCCCTATGTCACTGAATCCAGGCTGTCCTTA
TTATTAATAATGGACTGGCCGGATTCGCATTCAGCGGACCATCTACGGTACGAACCCTCAGCGGCGGTTGGGATGAGTTCGCGGAATACTCAGCGACCTT
TGGAAGACACGTTCACCGTCTGGGACAGGGCGCGGACCGTTAAAGATGCTCATGCGACAGTGCAGACGACGCTTGGCATGCAAGAAGATCCATAACGGAT
CATTGTTCATTTGATATTTGTATACTTGATTAGGACTTCTTATTAGGAATAGACCCGAAAGGGTAAGCTTAAATACAGAACAGAATTACCACTCAAGCAC
ACAGAGCGACGTCCGGCTTCAAGGTAAGCGTCAGGTCAAGCTTGTTTGAGTGTGTTATGCCTGTCGGTGAACTCGAAGCTCTGTAGCGAGGGTTCATCCG
GCAAGGCCAAGAGACTTTGTGTATTGGCCGATTATTATCGGGAGGTTTTACGTGACGGCTTATTGTTGCGTATTTGCACGACTGGGAGTGCTTGAATTGC
CTACCTTTTACTTCTTCCAGCCGAGTGTTGAACACTCGGTGATCTCGTAAAAGGCTTACCCGTGCCTGGTACCCTTCCGCTGTTGGGACCACGAGGATTC
AAAACACCTGCTAGCTTTGCTCGTGCTAGTAGCGTGTTCTTATTTTACTGGTTGGCCTATATAAGTAGTTTACAAGGTCCAGTTTGTCCCGGTGCAAGGG
CAGAACTGGGGTCTTCAGGTCCGCCCGAACGATCGTTTACTATCCTAGTAGACGTATTGTTGTGGGAACATCCTAACTACATCTGTAGCTAGAGTTCACG
TGGGATTTCCAACACCACACCCAGGCGTACTAAAAACTATTATGATGTGGTTTAGAACAGTGTGTAACCTCGATTACAACGTAAAGTAGAATACAAGGAC
GCACCGCGGGAAGGGCGCTATTAAATTAATGAACTCTAAGCCAATGTTTTTAGAACGACTCTAATGCATGTAGAAATCTACTCCCCACCAATTCGTTTAT
TGTAGGTATGACCATGAACGCTCAACTGCTCATTCTAAAAATATCTGAGTAGCTTTGACATATATTTTGTGTACATGTACCTCTTCCCTGATGGGTCCTC
CTTTGACACAACCATAATCGATCCATGGACCAGCAGTATGCCAATTCATGCTTCGACCAATTAAGCCGTCAGCACATAATAAAGTGACGTGCATGCATTT
TTGTTTGTAGCTGTAATCTCCACCTGACCTGTGCGTTCTTCAAAGTTAAGACGTTTGTTCGTAGAATAGCGCCTAGGCACTCAAAATGAATAAAGCGCTC
ACTGAGCGCTACATTTTATTAGTATGATGAGGGAGATCGAGTTTTGCGTGGTTCCCGAAGGTGTCGAGCTCGACGGTGACTTCGACTGCCTGGAATTGGT
GAAGGCCATTTACGGTCTAAAACAAGCTTCGCGCGTGTGGAACGAGACCTTTGACGAGTTCGTATGCTCTATCGGCTTTCAAGTTTCAGCCTTTGACCCG
TGCCTCTACATCAAAGTTGTTGATGGCCACTGTGTGCTTATACTGGTCTACGTCGACGATGTCCTGGTCACCGGAAGCTCACCCGAGCTGATCTCACGCA
CGAAGGACGACCTCAAGGCACGCTTCGAAATGACTGACAGCGGTAAGTGTGTGTTCGTCCTTGGGATCGAATTGGTAGACGGTCCGGACGGCAGCGTGAC
GATGAGCCAACGGCGTTATGTGGATGACATCCTGAAGCGCTTTGGTATGGACGAGTGCAAGGATGTGGTGCGTCCGGAGGATATAAGCGCTCGACTGGTT
CCAAGCGACGCGGCGACCAAGGTACAAGCTCCGTTTCGCGAAGCTGTTGGTGCCCTAATGCACGTGATGAACGCGACGCGTCCAGATATTGCGTACGCGG
TGGGCTATGTGTCGCGCTTCAGAATCCCCAAGAAGAACACTGGGTTGTGGTCAAGCGTATCTTTCGCTACCTGCAAGACATTAAGACGCATGGAATCTGC
TACAAGCCGGGTAACAACATCGACTTTCGCGGATACTCTGACGCAGACTGGGCTGGTGACCTCGCGGACCGCAAGTCAACTTCCGGCTACACGTTCATGC
TGATAGGTGCGCCAGTGGGCTGGGGCAGCAAGAAGCAATCAAGTGTCTCGCTGTCTACGAGCGAAGCGAAGAATCAGTCTGGCAATTCAAGAAGGCAAGT
GGATTCATCGCCTGTTGTGCGAGATCTTAGCAGCTGCCAATGAGACTGGACCCGACCTCAAGATCCAAGAAGACAACCAGTCGTGCATCAAGATGACGAA
GAATCCTGTGAAACACAGCCGCGCCAAGCACATCGACATCAAGCACCACCACATCCGCGATGAAGTCAAGCGTGGTGAAGTCAAGCTCGAGTATTGCGAG
ACTTCTGTAATGCTGGCTGACATCATGACGAAGGCGCTCCGAGGGCCTCGTCACATGGACCTAGCAGCTGCTCTCGGCATCCACGCGTGTTCGCATTGAG
GGGGAGTATTGAGGGTTGCTGGTCTTGGTACTGTGTACCAGCTGTACTCATTAATGGTCAGCATGAACTGGTCAAATACGATCCCGCTGTGATTATGGTA
AGCTGTTTATGCCATCCATGATTGGACGACCTAGGTAGTGGACAGTGTAAGCCCCAATAAATCAATCACTTTCGAATCTTCCTTCTTCCGCTCAAGTGTC
TTCACTCCGGTCTCCGCACCAAGTGCAGAAGTCACTCCATTCAGCTCCAAGCTTCGTTTCAACACCTCTACACCATTTACCGTCACGCAACCTCTTCTCG
GTTGGGCGCTTCACCAAGGAAGTTGGTCCCGTGACGTTCGAGACGGAATGGTGTTTTGCGGAAGCAAAGGGTCTCAACGAAAAGCACGACGCGCGTGAAG
GCAAAGGGCTGTTCAAGCTGTGTATGACACCAGTTGTGCCCGACGAGGCCAATGCGGCAAGCTCGAAGAATCGCAAAGGGGACACCACATCGTACCTCTG
GCATCTTCGACGTGGTCACATTGGCCATGGCGGTCTAGACGCCATCGTCAAAAAGGACTACGGTGCAGGCATCAACATGATGTCAGTGAAACAGTGGGAG
CTGTGCGACGGATGTGCACTCGGCAAGCAAACGCAAGTGAGCTATAAGTCCAAGTCACCCAGCCACGCCAAGAAACTGCTGGAAATCGTTCTCAGTGATG
TTTGTGGTCCCATGCAGACGTCGACATTCAGTGGCAAACGCTACTTTGTCACGTTCATCGACGAGTACTCGCACTTCTGTGTGGTGTATTGGCTCCGGAA
CAAGTCAGAAGTGGCCGACAAGTTTGCTGAGTTTGTCGCATTTGCGGAAACACAGACCGGCAAGGTCGTCAAGACGCTTCGTAGTGACAACAATGGCAAG
TACATGTCGGGCGAGATGGCTAAGCTCTGCAAGCGTCGTGGTATCATGCAAAAGTTTACGCCTCCGTAAACGCCTCAACTGAATGGTGTCGCCGAGCGAA
TGAACCGGACGCTGGTAGAATGTGCGCGCTGCATGTTGGAGCATGCTGGTTTGGCCAAGTCGTATTGGGGTGAAGCGGTAATGATCGCTGCGTTTCTACG
TAACCGGTGTCCCACACATGACATGTCACCGCACGAAGTATGGACCGGTAAGAAATCACTGCTGGCGAACCTGAAGGTGTTCGGTTGCCATGCGTATGTG
ACGTTCCGAAGCAGAAACACACCAAGTTTAACGCTCGAGCAGTGAAGTGTCGGTTTCTGGGGTACTCGGACCACGAGAAAGCGTATCGTTTTGAGGAGAT
CAAGAGCGGTCGTGTGCTAGTGAGCCGCG