Description :
From Genome Similarity Track
Location :
Scaffold_1207:4263- 6236
Transcript NameFunction/comments
Phyag_g9894hypothetical protein PHYSODRAFT_523131

Sequence
1973 bases(100 bases per row)
GGCGTCGCACTGGTCGTAGACGACATCAGCAAAGGATGCAACTTAGCATTCCGATATCCTGCGCCCCCGTCCGAGAGTGCATCCAGTTTCCACACGCTGC
CCGCGCCCCTATTGGCCAAGCTCTTCCGACCCAAGAACGCGTTGTGTAACGCCAGTTTCGAGCTTGTAGTAGACGATCTGCGCTTCGTGAGCCACCCTGT
GTTAGTATCCCGTCGTCTaccggctgcagctccagcggaCGGCCCGGGGAATGGTTCTACGTCGACAAACTGCTCAACATCGGCTGCAGGAGCTCCCCTT
ACAGTTGTAGAGCAATCTTCAAACGGTTCTACCTCGTCGTCGGGGAACGAGACTACCATGTTCAACATCATTTTTGCATTGGAAGACCGTCCTCCTCAAG
CATCAAGAGCAACTGAGACTAGGGATGGCACCATGGATACCCAGTTATTACCTTTGCAacaagcagatgaagaggaacTATTGgccagaagacgcagcag
cgctcaAGCGTTCCACACCGTGGCGGCGCAGTTGTCCAATGGACTCTTACATGAAGAGCTTCGAGTGGGTTTCGTGTCGAAAGAAGTGAGGGAGTTGCTC
CAGTTGAGGGATGAATTGGCACAGAGTGAACGCAGTGTCTCGGGGAATAACAGTACAGGGATCCCGGGGGTTACTAGTGGTAATAGTGTGAGCGtgagtg
ctgctgttgcagcgggTGCTACGAGTGGGAGCAGTATCACGAGTAatgcaggaggaggaaatgCGACCAGTGGATCGAGTTTGATGCACCATCATCATCA
CAGGAAGGACGGGGAGAATGGATCGTCGGCGGTGGATGTGGATCCACAGACGCTGATCGACGTATCTTTGGGGAAAAGCGTTTTGGCTAATGACCTGAAG
CGGGTGTTTCATGGACTGGAGGAATCGGGGGCTGCTCACGTGGTGTTGAATGGATGGGTGAAATTATCGCTGACGCTGACAGACGCGGTTACGGTGAGAA
TGGCCAGTTTACGACCGTATCATACACTTCTGCTACTAGCTGATAAAGAGGATATTCTCAACAAGCTACCTGCAGATCATGCACGGCAACTTCGAGACct
agttgaagtggtgaaTCCACTCAAGAGCTTTCAAGATATTGCGCTTGAGACTGGAGTGCCGATTCATCAAGTTTTTCGACTGTCAGCACATCTTGTGTAT
TGGGGATTCGGGCGCATTGTCGATGCCATCACACTGTACAACATTTATCAGGTCAATGCGAAGACAGGTCTGCACATTGCATCGCCACTAGCGCTGGAAT
TCCGGCGTAAGTTCGCGCCTTATGAACTTGCAGAGGTGCTGTCAACGTTTTCTGGATCTCGCCGTATTGGGGAGTACATGAAGACCTTGTCTACTGCCAA
GAAGACCGAGTACATCCACATGCTGATCTGgctactgcagcagcgatttattgtgcagcttcaccgcTATATCTATTTCATGATCCCGTCTGATGGAGAT
TACGCAGCAGAGCTCGGTAACGGCGGCGCATCTTCCGTTGGGAGTTCCTCTCCTGCTCTGATGGCGTCTAGCTtccgtcgacagcgagtAAACAGTAGCG
CTACCAATACAAGTGCACCTGGGAGTTTACCAATTGCACAGACACCACCCATGAATCCGTCTACCATGGCACTGCCATCACCGCCCCCAGCCCCGTTGGG
CGGAGATAATCCTGCAACAGATGGACGCGGGGGTAGTTTGGTGCCAATGGCGCAAGTGATGAGTGTGGCTAGCCAATTGCTCTTCACAGACCAGGAACGT
GCATACCTTGCCAAGATTGCCAAGCCCAATCCAGTTTTCACACTTTTCAAGCGGCTTTGTGTATATTTCCACGGAGAACATCATATCGAGGAGATTATGT
GGCGCGAAAATCTTTCTCGTGGAGAACTCCGCACTGTCATGAGCACGTATCAGGACATTATTGTTTGCTGTCT