Description :
From Genome Similarity Track
Location :
Scaffold_18:426241- 432919
Transcript NameFunction/comments
Phyci_91373Hypothetical protein
Phyci_562292Hypothetical protein
Phyci_180942Hypothetical protein
Phyci_63824Hypothetical protein

Sequence
6678 bases(100 bases per row)
CTCAGCAGCATCCTGCGTCTTGAACAGCCGTGCGAAGAACACCTTGGCTTGCTTCCTCGCAGCAGCGTCTCGCACGGGGTCCAGCAGGTCTCGCAGCCAG
CTCCAGTTGTCGTCGTTGAGCACGGTATCCGCTACGCCCAAGTGCTCGAGCTGCTCCTGCTGGTCTTCGGTGGACGCGCAGCTTCCGCACGAGCTCGGAG
GTGACTGGGATTGCACTGGTTCTCCGTTGGCGATGGCGGACTCGAGTGCTTCAGCGGTGAGCGACGGCGCCATGGTGCTTCGCGTGTCCTGGCAGGAAAT
GCTGCTGCAGCAGGACGCGAGTCGCTGTGTGACGTGTGCTAACCTTGGGGTCTCAGGTCCGTCCGTTACTCGTGCCTCTTCGCGCGCAAAGGACTGGCTC
TGGGCGACTAGGTGAAGTCGCAACTACGCACTAGTTCCGGATGCTTGAAGTTTGTCCGGATCGGAGCTGGAAGATGATACCGTTGCCGTAGTGCTCCAGC
GCGAAGCTCAGGATCATGAGTGGCAGCGTGAGGAACTTGGCTCGGAGCACAACTACCCCGAGTCGAAGAGAAACCAGGACCAGGTACACCGCCAAAAAGA
CCACACCCAAGCTGTCGAGCAGTAGCAAGTGGCGTACCATGCTCTCCAGTGCGGCGGGCGTCGCCAAAGTGGTCATTGCGGCAAAGTACTTGCGGTTAGG
CAGCCGGTACGCAGACAGAAGGTAGGTGCCTGCCGCACAACTTACACTGGTCAGCACAACCAAAAGTAGAAAAGCAGCGCATTGATCGTGATGTACGACC
GCAGCAAGGTGATCTCTGGCTGGTGTAATTCTGAGGTGACGCAGTGGATAAAAGTTTCCTTCCGGTTGCTTCTCGGCTCCGTACGCGCCATCGTTGCCGG
TTTTGATGCCGGAAAATCATGCTGGAGTGCTTCAACGCGAGTGCTCGCCGCCGGATTCCCAGAAAACGGGGTAATTCTAGTGAAGCTCAGTCGAATCGGA
GATGCCGTCGCCAGATTAGACAAGGGCTAAGCACTGCTGAGCAGACTTTGGTGGTTGCTGTCTCGTCAAGAGCTATGGCAGGAGTCACGATCGTGGGTCA
TTGAGTCGGACGACGCTACTACATTCGCTTCCTGAAGCTCTTGACATCTGACTGTGAATCCGACTCCCTGATAGCCAAGATACTTCGAAAATATTCGCGA
AGGTGCTTTATGGTGGAGATACCTCGCTACGTGCTTATCTTCGGCCAACTTCAAGCCAGCATAGACAACACTCGGACTGACCATGATCCCGAAAGCAGCG
AGTTGCTTTCGTGACCTGTCCAGCGCGTCGGCATCCTTCAGAACAGAATATCTCAGCGTTCGAGAGGTTATTCACAGCAGTCAGCGTCTCGGGCGATTTC
GCGTTTTGTGGACACATCGCTGTGAAGAGAACGTGGTATAACTGCTCGATCGTGCAACTGGTAGGCCCTACCAGATCCAGATCATCTTTAAACACGAACC
AAACCAGTTCGCGTAGCTGTTGCTGAAGTGCTGGCAGGCGCGAATTGGCCGAACGGCACAGGAAAAACACCCACAAGAACCGAGACAATCGTGTTGGAGC
CGATCCCGACGTCAACAAGGGCCACGCCACAACCCGAAGTAAATTTCCATGGTCGCATCGGTAAGACGGAATTGGGCTCAGCACCAGATCTTTGGCCAGC
GTTAAACGCGTCACCTGCTCTTGAAACTGGTTGCACCCATCAAGCTTGGCGATGGTATACTGCCCTGGAAGTCGCAGTAATTCACCTCAACCATCGCGCC
GTAACGCGGAACAATCCACGCACTCCTCCGAACTCGACGTAGGGCCGAGTGAAAAACTACAGGCGTTGGTGACACAGTCACCATCTGAATATCGGCTCGT
ATTTTGCTTTACTTCTCGGATAACTGCTGTCAGCGATATTACACCGTCCTGAGCTTGTATATGATGCCATTGCCGCAGTGTTCTAGCGGGAAACCTAGAA
TCATAATGGTCAATGCCAAAAATTTTGCTTGAAGAAGCACCCGCTGTGACCACAGCACGAACGCGAGAAGTTGAATACCTGGCAGTCCCAGTCGGCGCGA
GATTAGGACTAGGTACATCACCAGAAACCCCACTTCCGCTACTATCAGTAGGAACAAGTGGGAAACCGTGCTATTAATCGCGCTGGGCGAGGTCATGGTA
GCCATAGTGAAGAAAAACTTGCGGTTGGGCAACCGGTAAACAAGTGTCAGATAATTCCCTACAACCATACAAAACTGTAAGCTTACTGCATATAGAAAAA
GCTAAGGATCACAAAAAGTTGCTCACCGTAGAAAAACAGCATAAAGATGGTGATGTAGGACCTGAGCAGGGTAATTTCCGTCTGGTGCATTGTAAAGTTA
ACGCAATCGGCGAACATTTCGCGTTGTCGGGTAGAGTCAATTTTTGCTTGGAAAGAGTGGTCTGTTCGGCTACTAACATCATTCTCTTTTGGTAAAACGT
CTTGCCCTGTTCCTTGTGGATCTAGACGAGAGTCAGCAAGGGGAACGGCAGATAATGGGGAAATCAAAGCAAAGCTGTGCCCAATAGAATAGGTCGTTTG
CTTCAATAACGATTTGACTCGGAGTAGGCTTCGGTACCTGCTGCTTCGACTAGGGTTTTGTACAATTTGGTTGCCAACGAGAGGATCACCGCTTCTGGTT
ACTGAAGGCTCATCTTGCAATAATTTCTGATGTCTTTTCACGAAGTTGATACTCTGAAAGCCCGGGAAGCTTGAAAACATACCAGACGGTGACTTTCGGT
GAAGAAGCTTGGGCAGTGGCTCTTGTTGAGCTAGATGCAGAGCAGCCGATATAATATCCTCCGTTGAGACAATCTCGAAGGCTCGGAGTTCGTCTTTAGC
TCTCTGCAGCTTTTCTCCATCTTTCAGAATATCATGGCAATTCATAGCCATTTGCAGGGTGCCCACCCCTATAATAGCCGCTAGCGTCTCCAATGATTTA
GCATTCTGAAGGCACATGGCCGTGAACAGAACGTGATAGAGGTGACCGACACCACACATAATTGCGCCGGCAACATCTACATCCTGCCTTAACATCAACC
ACAAAACGTGGCGCACAAGAAGCTTAATCACTGGTAATAGTAAGGATAACCAAAGTTGTTGGGTAGATTCGAGCGACATGAAGACGGCAGTTAAGACGGG
GTAAACAACAGCCGGGAGCGTGTCCATCGTCAGCCACACATTGATCTTTTCAACCCGTTGTTTAGTCTCTGGACTTCGCGGAAGTAGGCGGTTGAGCATA
AAGCCAACAATTGCCATCGGACCGGCAGGGGCAAACTGGGTAAATGGCACGGGAAAGACTCGTGCCACGACAGCAATTACGACACTAGTTGTAGTCCCCA
CCGTCGCCATCACCATCCCGTACGCGAAGATAAATCTCCATGTTACCGTCGATAGGTTCGGCAAAAAAGCAATTTTCACGAACAGGGGCATAGCTGTGAA
AACCAGGCTTGTAAGGTAGCTTCGAATCTGAAAGTGTAGAGATCCTTGAAGCCCTGTTGCTGGGTCGGTGAGCGGGATACTTTCGATAATAAAGTTGAGA
ACGAAACACGGCACTGGGGTCAGGATTAGGATGGATAACACCCTTGAGGTTGTTGTATCTGTTCGAAAACGGTCGAACGTGTCCAGCTTTGCAATGGAGT
ACTCCCCAGGAATTCGTCCAACAGCACGTAATGCCCGTCGGCCGACAACCCTCAAAACTTGCGTGCTCCTTGTAGCCGAACGCAGAGCGAGCTGATTACC
TAACGGTATGGGTGACACAGTTGCCATTGGAGCGACGGAACAGAATGCCGTGCGTGGGTGTGGGCTTAGAAAACAGTACTAAACTATTGTGACACTATAA
AAAGCCTACGATTTGAATCACGATGACAACACCAGGACCTGGGAATGAGCTTTAATATCTCTGGTGCTTCAAATTTTCATCAGGCTGTGTGAAGATTGTA
AATGGCCCCGTTCCCGTGATGTACGAGTGGAACCCTAGAAGCATCAGAGACAACCTCAGAAACTTGGCTTGGACCAGAATCCCCTGGGATCGAAGAACAA
GTGCAAGCTGGTACAGTCCGGGCATTCCAAGTCAACGCTGGATCAGGGCGAGGTAGGTGCTTGCGGAAATGATCACATAGATAAAGAAAATGTTTGGAGG
TTTTCGCTATGTCATTGATTGTTGTGATCGAGGCCAGCGTGGCAATGTACACTCGATTGGGCATCGCGAAGGTGAATCCCAAGTACTTCGTAGATGCCTA
TTCAGATAATTGCGACACAAGTGCACAATGTTAAAATCTGACAAAGGAGAGCTGGTCGCATTTTCGTAACGCACCGTAGAACAACAATGTAGTGATCGTG
ATATACGATCGCAGGAGAATGACCTCCGTCTGGTGAAGTGCGGAGGTAACGCCGTTGATAGAAACCTCCCGAGAATCTATTGAGTGGGGCTCCGCAACTA
ATTTCTTTGAGGATGCCTGGACCTTGATCTCGTGGAGAGCTAACAGGGTCAGCTGACGCGGGGTGTCTGTTTTCACTTGGACATTCTCGTTTCCAAAAGA
TTGGCTGATGATTCGGTTGTTCTCCCACTCGACCGAACCGTTTGTTGATTTTTGAGGTGATGGACGCTGGATTATTTCGGTGGGTGAAGACGCCCGTGAT
TCAAGTACTTGAAACACCGTATTGTACGATGCAGTGAAGGCCTCATCACTGTACGATGGGTATGCCGGTAAAAGCGTTGACGGAAACTTGGACTGCAAGC
TCATTGCAACAGACTCATTACGGATAAGATGCAACTCCGTGTAGATGGCGTCACCAGTTGCCAAACTTGTTTGTCGCGTTGAAGCTGCTCTCTCGTATCG
TTCAGTGTTACAGCAGCGCGTATTATGTAACGACAAATGAACAGCGTCTGGATTGTGTTGAGCATTCCAACGAAAAGTAGCGTCCTTGCCGACTTGGCAT
TCTCAAGAATCAGGCTGGTGAACAAAATATGATAAAAGTGATCGGCGCAGCAAGAAACTACCCCTACGAGGTCTTGACCATCCTTTGAGGCCATCGTCGA
AGTGCGAGCTTAATCACGGGGAGGAGCATAGATAACCCAAGTTGTTGGTTTGACGATAAAGCCATGGATACACCAGTGAAAGTAGAGTAGATGATAATAG
GAAGGAACTCCGTCATGAGGCGGCTATCATCCTTGGTGCACTTGGCTCGAAAGGCGCGATATTCTGGCCCCGCTCTCTGCCGGTGGTAGCATACAATCGA
CCCCATCACTGCCATCGGAACCATTGGTGTGAACAACGAGAATGGCACGGGATAAACGTGTGAGCAGACCGCGACCACAACGTTCGTCCCGATGGAAATA
GTCCCTTGAATTAAGCCAAATACCATCAATGCAGTCCATGACCCAGCCGAAAATTCTGGCACGCAGTCTTTCTTGATCAGCCCGAGGGTAAATTTTGGAT
GGAGGGTGTTAGGAAATGCCGTGCTGGAAAAAACTGAGCGAGTGTCGAAACTATCTTGCAGTGGGCAGATTCCATCACTAGGTTAACAAGGAAGCGCGGC
AAAACTGACAGTATAAGTATTCCAGCAACCTCCCACCGAGAGGTCTGAATTTACCGACCGTGTACTGCCCAGGAAGGCGCCCTACGAATATACAGACCCG
CTACCAGAAAGAGTGAATGCAGCTTCCATATCGTGGACAGGAAAGAGTAGGATTTGTGCTGGTTGGAAGCATACTTATTCAGAGCGATGATCAGCAATAC
AACGGACGAACTAAGAGACGGAATTCCCAGTGACCCAAGGAGGTCAGTAATAAGGACAACAAGGAAGTGCACAAAATAATGCTGCTATTTAGAGCTCTGA
TGAACTTGATGCACTTGGTGAACTAGCATCTTATCCTTCATTTTGAGCTGCAACGCTTATGGGCTTAGTAGATGGACGTGCAGACGGAAAATCAAGCATC
GTGTCGAAAAATTCACATGTAGCTGTACTAGCTTTTAAAATACAATGTTAAATTAAAGGCTGTCTGAATCTCATTAACAACTTGGTTTGCTTAGCTCGTA
AATGCTGTCATTCCAGTAATGAGCAAGCGGTCGAGGACCTTTTACACAGTGTTAAACAGGCGGATGAACGCGAACGTCTGATAGGACTTGGCATTGTGAA
GAATGACATCCTTGAACATGATGTGGTACAAGTGCCCTGCACAGCACGTAGTTACCCCAATGAGATCTTCGTCCACTTTCGAGAAAAAGTAGAGACCGCG
ACGCAGCGACAACTTGAGCAGAGGTAGCAACAGCGACAGCCAAACCTGCTCGCGTGGTGATAAGGCACGAAGAAGGCGCTCAAAATAGGGTACACTACAA
TCGGGAGCGGTGCCATGCCTAGTTGATGGCCCACGCGCCTGCACTTGGCTTGTAAAGCACGACGTTCTGGGGCCCGAAGCTGACGATGGAAACATAGCAC
GCATCCAACTATGGTCATCGGAATGATTAGCGTGAACATACAGAATGGCACTGGGTATACGTCAGTCGCGAGAGCAATAAAAATGTTGGTTGAAAGCGTG
ACTAGCCCTTGGACGATTCCAAAGCCCGTTTTGGGCAAAATCGAGCCGATGGGGAATTCTGGGACGCAGTCCTTCTTG