Description :
From Genome Similarity Track
Location :
Scaffold_44:4262- 9543
Transcript NameFunction/comments
Hyaar_Emoy2805912betacateninlike protein putative
Hyaar_Emoy2805913betacateninlike protein putative

Sequence
5281 bases(100 bases per row)
GTACTGATAAACAAGCACACTAAAGGGCAATCATCAATTTGGCTAGTGACAACGCGCCTCTCAGCAGCTTACAAGTGTAGGTTAAACCCACGGCACAGAT
ACCCTCTGAACTGCATCAGACAGGTAAAGTATCCCAACAGAGTGGTTATTTTACTCAGAATAGAGCTTGATTCGTGACACGACCAAATATATTTCGTAGT
GTAGTGGCAGCTAAATATTGATGTAATAGCGGGAAACGACATCGGCCTGACTGCTCCTTCCGTAATAGTTTTGTACTTTGATGCTGCGTCGATTGGCCTA
TCGAAGAGTAGCAAAGCATTGTGCAAATGCATCTGGGTATGCAACAAACGGATCATGTCTCGTGTAACACCCAGGACCGAGCTTTTAAGCCGCAAAAAGT
TCGAGCATTTAATGGCTTGCAGCATATCGAAAAACTCCGTTTTGACGATGGAAATGTGCTACTTCCTGTACACATAATAACATCAGTTAAATGTGGTATT
TGCGCATCATCCGTCAGCTGCTTTATGATAACAACATTATGTAAGCATAAAACACCCTTTATTAGCGACACGAAAAACTTTGTCAGCCCTCGCATCGACT
CAATTACAGATTGCTCGGTAGTATTCCAACCAAATAGAAAAATGCTATACCCTGTCGTGAATACGTACCAAGATACAAAATAGAGCAAAAAAAGACATTG
CTTATGAAGCTGCCTAACTTCGGCATCCAAAACTGTGTTGGGACAAAAACGATTTTTCCATGTCAATAATCCTCTCAACGTCTAGCGCCGCAAAAGTTGG
CCTTGAGGCGTAAGCTGCTGAGAGGCGCTTTGTCATTAGCCAAATTGATAATTGTCCTTTTTTGTGTGCTTTTTTATCTTTCGACAATACACAAATGATC
AAAAGTGTAATTTCGAGTCACAATCGGTACTAAAATCTGTACTGTCATACGTATAGTATACGCCTCGGTATATTTTGATTTGTTCAGTATTTGGTTGATG
GGAAACGTTAGCCACCCTCCAGGTTTTCTCTAACCACCCACCACCCCTATATATTACCGTAATTTACTCGATTTAACGCCTTCTGGTAGGATTGAGATAA
TCGCCGTCATGAAATATATATTACTGTTATTTACTCCATTAACGTCTTCTGATTGGTAGGATTGAGACTATGTTACCGTAGGAAATTCCATTGTATCTAC
TCACGTTACACACCGCAATATCAGATAAACAATCTCCTACATCCCCCAAATTTGTCAATATTTCCACCACAATTATTAGAACATCGTATCGCGGAATAAT
CTTACTATAAGAAAGCCACGTACTGGAGTGGCCCTGTCGACCTCCTGCTCTTAGATGCAGATGAATATTTCTCACTCGTCGCTCGCAATATTAATCTTGT
TAAAGACACGCTTCTTATATCCTTTACTACATCAGCGACCTCACATGTCGAGGTATATTACTTCATTAGCGTCGAATAGTTACCCACTTCATCGCTTTCG
TCCCACGTACGCCGTCCAGTCACATACCAGAGCACCACCGCAAAGTTTTCTTTTCGTGGCGAACACATATTGGAGCCATAAGAGCGACACACACGTACTT
CTGTCGTTCTTGACAACACTTTCTCCATTTATGACACGTGCACCAGAGTCTTGCAATGTTTACGTCTTGGCCTCGCCTTCAACATGCTGGAATCTGAAGG
CAAGTGCCGCACGGCGGTTAAACGCGAGCAATTTGAAATTGAGCCAGGTAATTGTACTTATTCATATCGGGGATTTCCCCCCAACGTAGGTTGCCGCCAC
TACTTGCTGCTCGGGTTCCAGTATATAGTGGAGGAAGTAGCCGCAATGTAAATTACCACACGTCGCCGACTTCAAGACATGCATAGAATATTCAGAGCTA
GTATTTTATGATCTGTAAATTTGATTCTAAATTACTTCTGAGAACAGTGATATTCTCAATCGTATCGCGTTAAATTGAGTAAATTACGGTAATATATAGG
AGTGGTGGGGGGTTAGCGAAAACCTGGTGGGTGGTTAACGTTTGCCTTGGTTTATTCTTTTTGTTTTCCCATCTTGTGATATATATTTTTGTTTTCCCAT
CTTGTGATATATATTTTTGTTTTCGCGTTATCTAATTTTTTTCATTGCTAATTCATTGTCTCTCTTTACTCGTACAACTCGCCACGAGTGACTCAACTGT
GTACCCATTTGTTTCATCGTCCATTACTGACGAATGGAGAGCCATTTTGAGCGAGTGCTCGCCGCGCCCGTCGCTGCCAAGCGGCCTGCTGCCTCTACGC
TCGCACCTTTAGCTGCTAAACAACCGCGTGTATCTTCTAAAGCTATCGCCGCAAAAATTAGCGCTGTAGTCGATGGCGCTGAAGAACAGGAAGGCGACGC
CCTGGACGCCCGATCGCTCAAGTCGATGGCCAATTCGCTGCTAAAAGAAGTACAGCGCAATGCGTTGGACCGTGAGAAGCACGCGGATGATCCACTTAAG
TTTCTCGAGTCGGAGTTGGCACTGAATCTCCAGCTGGAGCGCTGGCAACAGGTAGCTGCCAAACCCGAGCTGTTCGGCGTCATGATGGAGCTACAGGTGC
CTCGCGTTTTACTGGGACTGTTTGGACATGAAAATGTAGACATTCAGCTTGCTGTGTTAAGTCTATTGGCGGAGCTGACGGAGGTGGACGACGCTGTAGA
GTCACTGGGGCCAGCGAGAGAGCTCGCCCACCATCTTGTGGACGAGAAGCTGCTGCCGTTGCTGGTCAATAACTTGTTTCGATTAGCTGCGGCAGATGAT
GACGTGGAGAAGGACGGTCAGAATGCAGAGGAAGAGACGTTGGGTATGTACCATTCGTTGCAGATTCTGGAGAATCTAGTCGACCTCGAGCCCCACGTGT
GTGTTGAGGTGGCGGTGAAGACGGAAGTACTGCCGTTTCTGTTGCAACAAGTGGTGCCGACGAGAGAATTTAGTGAAAACAAGCTGTATGCGAGTGAGAT
ATTGTCCATTTTGCTGCAGTCAGGAGCCGAGCCCAGAGAGGAGTTTGTAGCATGGTCGAGGAGAAAACGGCAAAAGAAAGAGACAGAAACTGTGACGACT
AACGGCAGCACCAGTCAGATAAATCTCATGGACGACTTACTGCAAGCACTTGCTCCGTATCGGAAGAGAAATCCGGCTAGTGATGAAGAAGATGAAATGG
TAGGGAATTTGGTGAATGCTTTGTGCAGTGCGCTGCTTGTGTCGGAAGCAAAGACACAGTTTCGCCATCTGGAAGGATTGGAGCTGCTGCTGCGCTGTAT
GAAAGACCGTCGACAGTTTGTCTTTGGCGGCGCATTGCGTGGTCTAGATCACGCACTCATGGGCAGCGCGCGTAATTGTGAACGGATGATCGAGATCGGA
GGCTTGTGCAGCGTTTTCTCAGTCTTTATGGGACGGCTTGGCAAGTACAAGTCGCGCAGCAACTCAAAATCGAACAAGGTAAACGAGCATGCGTTGCAAG
AAGAAAACGTGGTCAGTTTAATAGCTTCCATGTGTGCTTGGGTGCGTAAAGATGCTCCTGCTGATGTCTATGGCCGTCTTCATGGCAAGTTTGTCGAAAA
TGATATGGAGAAAATTGACCGATTGGTGGATCTGTTTGTAAAGTATCACGAACGCGTGGAACGTAGTAGTCATGTTGACGAAATGGAGGCTGAAGAGGAG
GATGAAGAGAGTCGGTACTTGCGACGTCTCGATGCTGGTTTGTTCGTATTGGAGCGCATCGCATTCGTGGTGGCACATTTGTGTCACTTCTCAAAAAAAC
TACGGGCCTACGTAATGATCAAGTTCCACGAACGCAGTATTGATAGTGCGAGCTTGACAGCTACCTTGCGCAAGCAATTGGAGCTTCTGGTGGCCGGTGA
AGACGCTAAAAAAGATAGTGACGAGACAAGGACGGAAAGTGGAAGCGACGTGGTCAACGACGAAGCTAAAGAGGCCCACAAAGCACAGCTCCAGCAGCTG
TTGGAGACGCTCGAAGCCGAAGAATAACCACCCGTGGACGATGAAAATGAGTCAACAGAGCAGGAAGAAGCGAAGACTAATGAGAAGGTTTAGCTACTGT
TGTGTACTCACTGCGATGTTTCCACAACAATAAAAGATCTACCTTATTTCCCCAGTCATGACAATGAGTCGCCGCAAATGTCACATTGTCTATTTGAGCC
GTATGAAGTAGCCGTGAGAATAGGTTTGCGTGACATGGGTGGTATGCTGGATTGGCCTACGAGAACACCAGAAGATGATTGCACCAGAAACGATTGCATT
CGAAACGATTGCACCATATTTGTTTTCCTTTTGATTGGACCAGAAGGTGATTGCACCAGAATTCGCTACCCTACATATTTAAGTCCCTCCTACTCAATAT
TCATTTTCCATTTTCTCTTTAAAGACTTGAGCTCCACTGCCAGCCACGGGCCAGGTTGTCATTTTGCTATATCAAACTTGGCCAATCAAGACTAATCTCA
ACATCCCGACCAAGAATCCCGTCGCCTTCATATGGGACATAACAACGAGGATGAGTACGTCACGCACACGATCGTAACGGTATAAGAAGTGCGACCACAC
GAGCTGACTTCGCCAACATGAAAATCAAGCGCTTTCGCGGTGGATCGGCGATGTACATGATTACATAGAGCATGGCGTTAAAAAGCCTCGCAAAAAGAAA
AGGCTGGGGCGCTGATCTACTCACGGTCCAGCTGCTCACGCTGATTGATGGCGATATCTTGCGTGAAGTAGAGCGCATCGCCAGTGACGCTTCCGAAAGG
GGGCTCACGTTTGAAGCGTTCTACCATGAGGTTGGATTACTCGTTGTTCCAGCGGACTACAGAGAAGACCTATACGAGGAGGTATGGTCTTTGACCAAGC
GTTACGGCACGACTGTACAACGCTGATCGGCACGTCTTCGACAGATTGTACGAACGTAAGCTGAGCTGCCCAAAGATGCACAAACCCTATGGGAGCTACA
TTGATGCCGCTACTATCACCGAGCTATGCCTCCAAACTGTCAAGACAAGCTTGAGTGTTCTGGAGCCTCGTACGAGACTATGACATGTAATTCAAGCGCC
TTGAAAGACACGAGAAACAGACTGGCCGTAAACGATCAAACGGTCAAGGAAGCCACAGTGGAATGGGTCACGGTCGGCGCTACCAGCAACTCCCCTTTAT
TAACAGCAGAGACAGGCGCAATTAATGCGAACACGCGACTCGTGTGAACAGCGCCAACCCCGATAGGGTGTCCCACACTAC