Description :
From Genome Similarity Track
Location :
Scaffold_1654:4262- 7706
Transcript NameFunction/comments
Phyta_totarag13434hypothetical protein

Sequence
3444 bases(100 bases per row)
AACCAAAACCGCTCATGGTGAGCGTCAAGGTCTTCAATGGAAAGAAAGGGTATAATCTCCTATTATGGACCCGCGAGGTCGAAATGGCTATGAATTCAGA
CATTCTCCGAAGTGATCAGCAGCGTGTGACTCTGGTAATCTCTAAGGCCAGTGGAAGAGCACGAGACTAGGCACTCACATGCGGGGCGGCTCTTGATACC
TCTTTTCCAACCTGggacgagctgaagcgcCAGCTGGCGAGAGTACTTTCTCCGCCAAGACGCGCTGACCGCGTGCGATCTCGCTTCTTGGTCAGCCGTC
AGGGTTGGTGGACTATGGCCAAGAGCTACGCACACTCATTGCTGGCATGTTGCCTACCCTCTGCCTGAGATAGTCACTGCGACAGTGTTTATGGAATGTC
TCTAGACCGAGGTGGTTCGAACGGAAGTATTCCGAGCTCAGCCACCTTCGTTTGAAGAAACCACCGCGGTGGCATTGAAATGCCGAGCGCAACTTCAAGT
CGACCCGCCTTGGTTGGCGTGTACCACACTCTATCCCTTCGGGCGGGAACCCATGGACTTCAGCTAcgctgaggacgaggaagctgAACGTCTAGCTGCC
GAGCAGTGTATGAACATCCGGCGAAGCTGTACTTCTGGAAGTATTCGCCACTTACGCATGGGGTCATCCAGCGCCAGGCTCAGCAGAGCCAAAGCCCCCT
TCCAACCTGGACTCTGGTTCGTCGCGGGGAAACGGCAAATCCCAGTAGGGGCGGGGTGGCCTACTGGGGAAGAACTGCGTTTTGTTGTACCTCGAGGCGG
TATAAGTCGACAGGTCTCCGCCCCGAAGAGATCCGAACTCTCTAACACGGACCGTGTATGCAAGCCGGGCTTGCTGGTCGTCCAGGCGACCGTGAAGGGA
TTTGAGAAACCATGGGCAATTCTTTTTGACTCCGGGGCGTCGGGCAATTACGCTCAACGCTCCGCGGTGGAGGGAAATCAACTGTATGTTGGAGCGCTCA
CAGCGCAAAGGGATGACAGCGTCACCGTCCGTCTAGCGACGGGGACCTGTGTCACGGATCCCAAGATGGCGGTGGAACTGGGCGTGAAGTTCCCAGCGTG
GGGCGCTGTCTGGTCCCAGGCCCGGATTTGAGGTACGGACTCATCCTTGGCATGGCATGGTCGAACACCATCAGCCATGGATGAACTGGAGGTCGAAAAC
ACTAGGTGCTACGCACTTCGCTCCTGGTGGAGCATTGGTGAGTCATGAACCCACCTCTTCTaggaagcagaagcgctaTTGACGCGGGCACTGGGCTGAG
TCGACAATGGTGCTGGACATCGGTGTGTCCGAGTTGATAGACAACGCTGTTGTCGTGGATGTATATCCCAAACACGGCTCGACGAGCCTGACTTCGAGGG
GTGCTTGACGGCACGACGTGGAGCGACACGTACTCCGTTGAGGCATGACGCGCCACTGAGTGCTCACGCGAGCGCTGTCGATGGTGCGCCGAGGCGCAAC
GGACCCGGTCATGAAAGTGCGTGTGGGGTGGGACTTCTTTCACAGAATCAAGGGCGTTTATCGCCGAGTGTCTATGAGGACACATGTCTCAACTGGACCG
GAGGTACTTCTACACCTGGACTGGTGGACACTGATGGCGACCCGTTGCCCTCTTCCACCAGGTTTCGGGCGAGGATGAGGATGAGACGCAGAGTGTCTGC
AACATCGTCGGACGAGGTGTCGAGCGTGGCGAGCAGCAACGCTCCACGTGACTGAAGCGATCAGTCATACACACTCACGAACGGAGTGGCGGGAGAAGTC
GATGGAGACATTAACCTTGAGGCTCTTCCCACTATTGCCGctcttctcgagctggacgggctggacgagctgtccgtcgccgagttcggtGAGGCCTCAA
ACGCGGGTCATTTCGCTGAAGTTGTCATGATACGACCTGAAGACGAATTAAACACCTCATCCCTCGTCGACAAGGCTGTCCTCAAGAACACCAAGCAGGC
GCTCAATGCGCGAAGTGGGTCTAAGATCCTTAAGGATCCGTACTATCCGTTGCTGGTAGAGTATAGAGACGTCGTCTCGAAGAACCCGTCTACGGGTCTG
CCTCCGGATCGAGGAGTTCGTCACGAGATTGACCTGGTTCCCCGAACCAAATACTGCGTGGTGAGGCAGTTGCCTTTGCCACGAGAACAGTGCGACGTCA
TTGACGCATTCTTCCGTGCGAAGCCCGAAGCTGGTATGATGCGTGAGAGTAAGTCCCCACACTCTACACCGACGTTCTGTCTGTGAAAGCCAAATGCCAA
GTGGCCCATCGTGCATGCTTTCAACAGACAGAATGCAGCCACCTTTCTGGCGCAGACGCCAATTCGTCGGAAGCATGTTCTCCATAATAATATGGTCGGT
TGTACGCTGTCCAATGCCCTCACCTTGGTCGATGGTTACTACCAGTTGTTCATGAGAGCGAGTGATATCCCGCTGACAGTCGTCAGCACTCCGGACGGCA
GGCTCTGGGAGTGGATGGCGATGCCCCAAGGGCTGTCGAACGCACCAGCGACGTTCAATCGTCTACTGACGCAGTTGTCCCAGCCCCATCGGGCTTATGC
ACCGACATACTTTGGTGATGTATTTGTTCACAGTCGTGTAGAGCACGGGAATGTAGATGTGGAGGTCCGCATAACCATGTGAGAGGTGTGCTCGAGTACA
TGCGCACCGGCAAGTTGTACGCCAACGCCGACAAGTGCGTATTCGGCGCGGAAGAAATCTCAGTCCTTGGATGCTTCATTGGGAAGCGAGGCCTTCGAAC
GGATCCTACCAAGGATAAAGCCATCGTGGACTGGCCGGTTCCAAAGAACCAAAGACCTTGCGCAAGTGGTTGGGCCTTGCCAATTTCTTGCACAAGTACA
GCAAGTATTATCTGAGATGGCCAGGCCATTGTCAAATCTCCTTAAGACGGATGCTGAGTGGTGTTGGGACACCGAGCAAGATAGCGCCTTTGAGGCGATT
AAGGAGATTCTCCTCCAGGCGCCGATCGTGGTGCTCCCGGACCTGTATTGTCCGTTTAGTGTCGTGTGTGATGTGGCCGACTTCACTATCGAATGCGCTT
TGCTTCAAGCGGACGCCGAACAGCGCGAACGTGTTTGAGTCTCGGCAGCTCAAGGATGCTGGGAAGAACTATCCAGTTCACGACAAAGAGCTACTTGCCA
TGAAGTACGCTCTTGTCAAGTTCAGGGTCCACCTGCTCTGTTCCAAACCATTCGTGGTTTAAACGGACCATGCGCCATTACGCACTGCGACGCAGACGCC
TCATCTCTCTCAGAGAATGACCCGATGATACTCCTTCTTTGCGGAGTATAACTTCGAGGTAAAGCACAAGCTCGGCAAACAGAATGTCCTGGCCGATGCG
TCATCACGCAGACCAGATTATGAGCTTGCTTACGACAGGCCTAT