Description :
From Genome Similarity Track
Location :
scaffold_43:42615- 45008
Sequence
2393 bases(100 bases per row)
CGTAAGGATGTCGCTATCCATCGTATGTCCGGCTGTACACAGTATATATACCTGATTCGGTCGATGGATATCACCAAATCTTGTTGAGAGAGGAGGACGT
CCATTTGACGGCTGTTAGTACACCGTCTGGTTTGTTATGGGAGTAGCTTGTGATGCCGCAGGGACTATCTAATGCCCCAGTATGCTCAATCAGTTGGTCC
CACATCTGTTTCGACCACTGGAGGCTTCGCACAGACCTAtttgacaatatttttatCCATTTGAAAAACGTAGATGGCAGATCTATCAAAGAAGTGCGCT
TGGAGCACCTCTGTATGGAGCTGGAAGGTTAAAAATCATTGCAAGCGAGTGTATTTCTGGTGCTAACGAAGTAACAGTCCTCAGTCGTTATGTTGGCGAG
TACAGTGTTTGTGCAGACCCTGAGAGGGTCAAATCAATCGTAGAGTGTTCGACGCCAGAAATTAAAAGTATTTGAGAACATAAATTAATTTGTCCATTAC
CCGAATCGCATCTCGCGTCACTACGCGGAGATGGTACGCCCGCTATCAAACATGCTGATGAAGGACGTACCACGGGAATGGCCATCCACTTGCGATGTAG
CATTCAATCAAATTAAGAATAGCTTAATGTAAGCACCATTGCTTGCTCTACCAGATGATACGAAGCCGTGTAGCGTagtatgtgacgcttcggagtgtgc
aatcggttgtgcactattgcaaaaggacGAAGAAGTATACGATCGTGTCTTGTTGTTGTAACAGTGACAGCTAAGGCCAGCAGAGGAACTACTCTGTCCA
TGACAAAAAGCTTCAAGCAATGAACTATGCTCAGGTAAATTCATGTGTTCACCTCTTGGGTTCAACTCCGTTTGTCGTCTACATAGAAAATGCAAGTTTT
CGTCATGCAGTTCAATCACCTCACTTGTCACAGCAAATGGCTCGCTGGTTGTCATTCTTCGCAATATATAATTTCGCGGTCGCGTACAAGCCACCGAAAT
TGAAAGTGCTGGTAGAcgcattgtcacgtcgtcccgattatgagctagctctTATCGATTATACCGAAAGCGATGTATATGCCAAGGGTGGGTTGTGGAT
GAATAGTGTGGCCTGATCATCGAGCACTGTCATCGAGTGATATGGAATTTCATGACAAGCTCCCTGGTCGCTTGAAATCAAGGGTGTATCGTTATGCATG
GAAGGATGGTCTCCTTTACATTGAAATTGCACGTGACGACGAGCCACGGATTGTGGTTCCCCACAACGAGGAAGTAGAAGATGGTGTACGAGGCGCGTGA
TACGTCGATGAACGGTCTCTTTGGCCATGAGAGAACTACCAATCTCTCAGTGTCCAATTTTTGGTGGCACCgcatgtacaagtgggtggcacgatacgtg
aagacatgcgatgtctgtCAGCGCGTGAAGAGCGCAAGGCACAAGCAAGTGTCATTACAGAGTCTTCCTGATCCTACTGACTGTCGGAAGTCAGACGACC
TCGACTTCATTTTCAGCCTCCCCGAGAATGCTGACGGCCACAATGGGGTGCTCAAAATTGTTGACAGACCCACAAAGATGGTTCGTATTGCTCCGTGTGG
CGATTCCATCGATGCCAGAGGTTCGACTAGATTGATCATTGATCATGTGTTGCGCAATCACGGGTTTCCAGACGCCATCGTGATGTTCGATTCACTCGTA
GCTTCTGGAAAGAAATGTTCGAATTCTTGGCACCGCTCGTACATGACCACAGCGGTCTACTCGAAGACCGATGGACAAACAGAACGAGCCAACTGAGCGG
TCGGTGGTGTGTTGAGAAGTTTTTGTGGAAAAAAATCTCACCGAATGAAGTTCGTTATTTTAAAATCTCACGGAATGAATTTCGTTATCATCATTGGTTG
AGTTTGCTATGAACAATCCAATTCATTCATCCACTAAATTTACGCCATTCTTATGAATGTTTGCGACACCCGCAAATAtcgctttgtgcgatgggtggCA
TCTTTAATGTAAGTCGGGGGGGGGACTCGGCAAATCGTTGTCTCCTAAACTAACACACCAATGATGCGCATATGAAACGTAAGTATAAGAATGCCCTGGA
CTTATTCTTCATGAGTCGTGTGATCCCAAGGGTGTAAGACGCAATGGCGAATGCGCAAGATCTGCAAAAAGGAAACGCAGATTGACGAAGTCGTCAAGGC
AAAACAAAATTATTGTGGAGGATTGTGTGTTACTTCGTACTAAGGATCTATTAGACGACGCGGTCCCAAGCTAAAAAGGCTAGAAGCTTTTACCTCGCCT
CATCGGTCCCTTCCGATAACTGTCATACCACGAGAATGCGTTTACTACTGATCTGCCAAGCTGGTAAAGGACCCATCTTACGATTTACATAGG