Description :
From Genome Similarity Track
Location :
Scaffold_523:4261- 5425
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_523-snap-gene-0.16Peroxisomal protein PEX19 family protein

Sequence
1164 bases(100 bases per row)
TTTTGAGAAATGGCGATTGTGCGGTTTACATAAGCGAGCACTGCTCGTTGCCGGCGCCGTCGCCCTCTGCACCAGCAAACAAAAGAGAGAGAGAGAGAGA
GATCCGTCCATCGTCAGCACCACGAAAGTCTCCCAAGTGAGGAGAATGAGACGTACGAGGGAAGCCAGGCATGCCGGCCATGCCGGGGAAAATTCCGGCG
CCCTTCACAAGAGACCATTAGCAATGTGCGGCCAGTCAACCGCAACAGCGCAACCGTACCATGTTGGGCATCACGGGCATGCCTTCACCATCGAACTCCA
GGCCCGGCGCGAGCTCCTTGACGATCTCGGACGGCGGCTGGCCCGTCTCTTGCATCTCCTGCATGAGCTCCGAGAGCCGCATGAAGTTGTCGGGCTCAGC
CTCGTACACGGCCGTGATCTGCTGAAAGTACTGGTACTGCTTGCCGTATCTAAAGCCGTCACCACCTCCGTAAATAAGCCACTGCGTTCGGATGTACGCA
AGGTCGTTGTGTTCGCACCGTTCATAGTCCTCCTTGGACAGCAGCGACTCCTTCTCAGCGAGCCACGCCGGATACTGTAACACAGTACGTCTCATGAGAC
CACCAGCACTGTCTTTCCTTTGCAGAGTGACGGGATCCGTACCCGCTCGCAGATCTGCTTCATGGGCTCGTACATGACGTCCTTGGACAGCAGCTGCTGC
ATCATTCCGTCTACGAGGCCCTGGAAGTCCTCCTGCTCGCATCAGACCACCCGTCAGCAGTTGTGGTCGGCCTCCTCGACACGACTGGAACTACCTTTTC
GCCCATGCCTTCGAACTGGCGCATCATCTCTTCCATCATGTCCTCGCCCATGTTCTCCGCGTTGGCCGACTCCATGCCTTCCATGTCTTCGGCGGCCTTG
GCCATGTTCTGCAGCGTCTTGGCGACGCCGACGTTCACGTCGAGGTCCTCGTCAGGCTTCTCTCCCTCGGCTTTCGCCTGCAGCGAGCCCAGCAGTCGCT
CCATGTCGGCGCCATCGCCTGCGCAAGCCAGAGTCAGAGACGCTGAGCCACGATGGCCGTGGCCAACCGTACGTACCTGCGGCGCCGAGTTCGCGAAAGG
CCTGCTCCAGCACCTGCTGGAACTCGGGGTTCTGCGCGTCGTCCAGGAACTTGGCCATGTTCTG