Description :
From Genome Similarity Track
Location :
Scaffold_198:42602- 49118
Transcript NameFunction/comments
Physo_144568hypothetical protein

Sequence
6516 bases(100 bases per row)
GTGGTTTTTGCGTGTGAACTGGCGCTCCGTTTTTGGGAAGATGCGGTGCAGTACGCGGCCTGCATACTCAACACAGCGCCGACCAACGTAAATCCAGAAT
GTGCGTCGCCGCTGAAGGTCCTGACGAAGGAGGCGTCTCAATGCAGCAAGCTCGGGGTCTTGGGGTCGCCATGCACGGTCTACAGAGCACCGAGCAACAA
GAACTTCTCGCAGAGAGCCCAGCAGGATCATCGGAATCGGCGAGGAGGTGAAGGGGTACAGGGTGTACTTGCCCATGGACAAGAAAGTGGTGACGTCTCA
GCACGTGCAGAAAATCGACACCCTGAACAAGACTGAGAACTTGCAGGCGCAGAGACTGTATCAAGACGGGGGCGAAGCTGAGGCGGAGGAGGAGTCTAGT
GAGCAGAGCGGCGGAGCTGCTGATAAAAACAGCCAAGAAAAAGAGATCTTAGACGAGGGAAAGACATGTGACTCGTTCAGTTGTGCAAGTTGTGTGAGTT
GAATCGGCCGAGGCCGAGCAGCAGACTACGACTGGAGGAAACGTCGTGAAGAACGTGATGAAACGCGGCCCCAGAAACTACAGAGAGGTCATACGCGGCC
GACTCAAGGCCGCCTGGATAAAAGTCATAATGGAAGAGCTCATGGCTCTGGAGCACAACGGTGTCTAGGAAGTGGTGCGACGGCCAAAGAACGCGCGCAT
CTTGCGCTCGAAGTAGGTCTTCAAGACGAAGCTGGTCGTCGAAGGGTTGATTGAGCGGCTGAAGGCTAGACATGTAGCCGCGGCAACGAGCAGGAACTCG
GCGTGGCGTTTGCAGCTGTCATCGATATGACGAAAGGTGATACTGGTACTTATCTCTAGTTGGAAGTTTGCTCTGGATCAGCTGCTGCACCAGACCAGAT
ATTGCGTACGCCGTTCACAAGTCGACGCGTAGGACGCATGCACCAACAGTTTCGAATTGGAAGTGAGCTAAGCGCGTGCTGCGCTATTTAGCTGGAATGA
GGTCGCTGAAGCTGTGTATGAAAGGACACGGTGGTTTAGACCAGCCGATGCGCGTGGTTGGGTACAGTGATGCAGACTATGCGGCTGATAAGACTGCAGG
AAGTTGACCGGCCATGCCGTCAGCTGGATCTGCAAAAAGCAAGGTGGTGTCTCGCTTTCCACGATGGAAGCTGAGTACACCGCCGTGTCTGTGGTGGCAC
AGGAATTGCTTGGAGTGCGGGAGCTTCTGAGCGAGCTGAAGGTGTTGCTCGAGGTGCCGATGAAGCTATGCGTGGACAACCAAGCTGCGCTAAAGCAACT
CGAAGGAGACCAGTCGTCAGGCAAGGCAAGGCAAGGTATATTGACGTGCGAATCAAGTTCGTCGGGGATTACGTGCAACGTGGTGGGTTGCAGGATGAAT
ACTTGGAGACCAAGGAAATGCTAGCGGACGTGCTGGCAAAGGCGGTGTCTGCACCAAAGATGCTCGAGCTTCGAGCTCGAATCGGGTTATACTGAAGTTT
TAAGAAAATCACTGAAATCGTCAGCGAGGAGGAGTGTTGAAATGAGGATCTGTAGAATCTGCAGATTCTACGATCAGGAGAGAGCGCCGGCCAGTTCAGA
CGGAGGTACAAGTAGATAAGCAGGTAGAGGCGGTAGCTTTCTAACCTCACTCTCCATTTTGCGTATCAAGACACAGACTGCAAGTTCTAACGTTTCTTCC
AACAATAATACTACAGTAGTAACTCTAGACTATCAGACAAAGCTCTGAAATTTAGTAGAAGCATGTATGTAAGGACCTGGTCGAACGTTTTCTGGGGCTA
CTGTAACCTTATTGTTGTAAAGCCCAGTTACTCTCTACAGCGCTTCACCTGCGCCTGCTTCGCAGCCGCAGGATCTGTTAAGCTGACATTAATCTTAGTC
TTAAGTTATCGTCGGTGTTGGGTGTATTGACGCTACCAAAATGCACCGAGTTGAGAGCCCTATGCGTGCTATCGGTGAGCTGGTCGACCTTGGAGGAGAC
GCCGTCGACCGCGCCACTACGCACTGTTCGCGTGCATGATGCCGGGCCGCAAGGACCTCAAGACCACCTGCAATTTCATCCTATTGGGCCACATGCAGAA
GTCGGGCTTCGCTCCGCCCTTAATCGTCATGTGCGAGAACATAGTTGCAAGCATCCTAGGTATTAACCACTTGGGGGGGGGCTTCAAGTGTAGCTCATGT
ATATGGGAAATTGGCTCACTGTATATGTAGTGTAGTAGACCGAGTAAGTACCGTCAGTAATACTATTTTATGTAGCATTAATTGTGCGCTGCCTGCACGT
ATTATCGGTAGTATTGGTAGTACTACTACAGCTCCACAAATAACTTGAAATTTGTAAGCACGCGTCTTATACTACTGTAGCTAAGTTGATGTATTAGGCA
GAGTCGAACCATGCAAAAAAGCTGCTCAGAAATCTTGCCTGTTCATGCTTCCTTTTACGACAATTTTATGCTTAGTTTCAAAACAAGCCACCTCCGGAGG
TGGCTAATACGTCAACTTTGGAGGAATTTCCACAAATCAGTAATTTTCACTGAGATTTGACAAAACGATTGTGATTCTTTGCCTGAATTCACTGACGCAG
CTACTTTCGAAGTTCAATTTCGACCCTGCGCAAATAAGCAACGTATTCGGTGCCTTTCGCCAGAGGGCCACCTGGGCAACCATTTTGAGGCGAAACAGCG
CCTCAACCGGCCGTCATCGACACGCGGAAGTAGATAATGGGCGACGACACTTTGGCGTGCTTGCGCTGCCACAGTACCGCTGCACGTCTCGCGCCAACAT
CGCCGTCGGCGGCAACCGTACGGACACCATCGAACGCGCTCACGATGGTGCAAATGGGCACTGCGTCTGCCACTCAGATGTCACAATGCGCACGCCCGAG
ATGACAAGTGCTCCCTCGCTGTGCTGCCCTTCGTCGGAGGGGGGGGGCAAACTGTCTACTAAGTACGATAATATTAGAGAAAGTTCGACACTCTCCCCTT
CGCGATTTCTGCTTACTTTTGCGTAATTTTTCTGCTTGCCAGTTCTGCACATGTGTGCTTAGTGTTTCTGCTCAATTTCGATGGCTCAACTCCGCCTATT
GTATATAGTCGGATAGCCCAATCTTAAAGTAATCGAATAAGAGTGTATTAATGCTATTTACGAGTGATATTCATTTCTAGCTTTTGATGTCCGGTTATGT
GCGAAAATGGATTGGTCCACTTAAAACACGATTATTTCGAAAACTCGAAATGGCGCCTGAGCATCATTTTGTTTTGTTTGAAACCGTCTCATACGCGGTT
TGATCGTCCGCTGTAGAAATACGCTTAAGGGCCGAAGTCAAAAAATATTAAAAAGTTTTAGACGTCTCACTTCAACAGTTATTGCGATTCACTACTGTAG
GATTCGGTGGACTTCCGTTACTGGGTTGTGTTCGTAGTTGAAGGGCTCTTGCTGCTACTGGTGGTTGTGCTGTTGAAGGAGCATTTAGTGGAGGTGATCA
ATCTCGCACCACCGAAGGTAAGTTCTTCGTCCCCTACCATGAGGGCAGCACGAACGTGTTGAAGGTGCTCGAGGTAAGTTAAAAGCGGACGATTTTAAGA
GCGACCAGATGTCGCAGGTGACCGACGTGGACAAGACATCCAGCGATACGGAGCCAAGAGCACAAAGACGATCAATCTGACTTGATTGCGTGGCACTGCT
GGCTAGTCCATCGTCAGTATTTAGGTAAGATTTTGTGCGGAAAAGAAACCTCACATATAATGAGTACTAATGTTTCGGTTTGTTGCTTTAGTCCGTGCCA
GTATTGATGTGCAGCTTCAGCTAGGTGAAGACCAGTATCAACATGGTGGAAGCAGTGACGTGACAACACACTTATCCGAATACCGTGTTCCCTCTACTTG
AACTCTATGCTTCAATAGCGCTCTGTTCCCTTGCTCACGTATCCGCGTCGGCTTTTGTATACAGCCATTGCTTTACTGGGCCGACCGGATAGCCCCGATC
TAGATGGAAGGTATTAAATGATATTTAGAGATGACGCCGTCTTTACAGAGGACTACCTAGGCATTTTCCGGGGCGGTAGGACTGGGGTGGGGTGGGGTGA
TACGACCGTTGCAAGCGAACCATGTCCGTTTACCGATGTACACTGGAAGTCCCGTGCCGGTTACAATTTTCTTGGTCACGATTGCCACCACGTTTACTGC
CTTTCGATTCAGCATATCAACAAATACTATGTTTGGCTAATGAGCCAAGCGGTAATATCAGCTTCAGGGTCGCGATGTAGACAAGCTTCTCAGTCGCAAA
AGGTTCGCTTTAAAGAATGATGTTGCTACTATTCTGCTTAATTCGCACAGAGCTCCCGTGAAGTTTCTAGCAATGGCGCCATTTTCTAGAAACGGGTCCG
ATAAAGCACCATCGCCAACCTGATCGACCCCATACCTGTTCACTGTTGTAACCTTCTCCCATGTTAGCCCGCACCCTCTCCAAATCACCTTCCCGGGTAG
CTTCTGCCATAGCTGTAATCTCTGCAATAAATGCTGCGCTGATCATATCTTTACACAAGGTAACATGCTTGGACAATTACTCCTCTGTAATCTTGTTGCA
ATCTCCTTCAGGTACAATTAGCACGCGACCAATCTCTATATTGGTATTGCCCGCTTGCCCAGGCTCATCACTCATTTTCGTAGGCGTTTGAACACCCCAT
CCGCGGTTAGTGTAGCTCGTCAGATCCTCTCTGCCGTGTAGCACAACGCTAGGAGAACTGTGCGGTCCTCGTCAGGATTGTTGCGAATGATCTCGTGACG
TTCCGCCTTTTCTAGCTCTTCTCAGCGTCGGTGCAAGCCTTTACCCACACGCTCCTTCAACCATGACTCGGTGCTAGCCGCATCGTGTCCGTCAGTGCGC
GAACACTGCGGCTTGCACGGAAGCACCGGGACGCGGCCACTGGGATACCCACCCGAAAAAGGGATCGCGCTTAGAAATACGACGGAGCCGAACCGCGCGG
TGATCCGAGTAGTAAAGGCGATTTACAGTGTAATTTGCCGAGATTGCGCCTCCGCTTCAACGGTTGCCCGACGCAATGCGCGACACGTTGCTAGCCGCCA
TCGGCCAGACAATATAAAAATAAAAAGTATCCTCAACTCGACTTACCCCCCTGATTATATCTGGCGAGTGGCAAACATGCAGACACCAGCCTTGAGTATC
CGTGTGGCGTGCGAGATATCGTGCAAGGACTCTTCGCGTCCGATGAAGAGCTCTCCCACCACATCCGAAAGGAGGGGTACTTCCCCTACACTGCTGAGCG
TCGGTTTCATGCCCCCGTTGCGGTCCGCTTGCACTATGAGCAGTTTTTTTCAGAGCAAATAATTCGCACCGCTCGTCCCGCCCAATGCCCTTCACGCGCT
TCCTCACGAAGAAGAACATGTCCACGGATCCGTTAAGGTGCTTTGTCCCCACGTCGAGAGTGTTAACCCCAGAAGGACCAAGGTTGTATAGGGCAACGTG
TGAAAGTGAACAGACCTTAATATGTTGTAGGTATAACATGTTAAGGGATGTACATTAGTGGGAAGGATGATAAAAGTCTAGATAAGAGGCTTTGAGGATA
ATATATTTGATGGCATAAAGTATGCAGGTATGTGACGTATAACCGTACTTATTACAGACCATACTAAAAAGAAGTGTTATCATGGCCTTAACATGGTGTA
TATTGCAACATGTTAGGCAAACGAAAGGTTATATAAGTCGGCGTGGTCCTTGGGGGGGTTAATGAGGTCCATAATAGGGCTCTGCGATACAGAATTTGAC
TTTGGAGTACGCTGAAAATGCGGCCCTTCTCCTCAATCTGCAGGCTAAGCTGCTAGTCAGGCCTTCCGAAAATTCGACTGCAATGACATTTAAGTCAATC
AGCAAAGTAACTTATTGTAGGGAAGTGCTTGGTACGGATACATACATTATTCCTGCTGATCGCGCAATATCGTACCACTAAGTCCTGCATCTCACTTTGT
AGCGTTCACTACGTCTGCTACCGTCTTCACACCCCACAGCTGCCGGTTCACCTTGAGGAAGAGAATGGTCTCCAGATGAACAGGAAGCAATCCTTGCCTG
TGGCTTCCCAGGACATGCTTTGCCTGACTGAAAAAGCGCTCGCGGATGTTAGAAGTGGGGGGGGGGTATCACTGCGATTTCAGGGTACTCACACGGCTGC
TCACGCAGCATTCTGCGTCTTTTTAACGCTCGATCCGTGAAACCAAGTTTTTTGTTCTCCACCACGGGGGACGAGGTTGCGGGGACGGAAAAAGGTGCCA
GTAGAGCTCGTTGCTGCGCTGTTAGCAAGTCCGTCTTGTTGAGAAGCACACCCACGCAGGCGTCCTCGAACTCAAGTTGATGAACGACAGCATCGTCGGT
TCCCAGGTGGCTTTCAACACCAGGGTGCTCAGCGATGAGAGCATCGAAGATGTCGCGAGCGTCCAGCAGCGACAGCCCTTCTGAGCTCTGTAGTTTTTTG
GACGATGACTCAAATG