Description :
From Genome Similarity Track
Location :
contig_50:426010- 429140
Transcript NameFunction/comments
g9956.t1hypothetical protein

Sequence
3130 bases(100 bases per row)
GACTACCGCGTGGTACCGCTGCCATCCTCACGTAGACCGCCCGCAGCCGACGCACCGCCCGAGTTTTGCTCCAACGTGGTGATCACGTCCAAGTACACGA
CGTGGAACTTCCTGCCGCTCTTCATGCTCGAGAGCTTCCGCAAACTGGCCAACGCCTATTTTCTGCTGGTCTCCGTGCTACAGTGTATCCCCAGTATCAG
TAACACCAACGGCCTGCCCTCCAACCTGCCCGTGCTCGTGTTCATCCTGGCCGTGGACGGCGTGTTGGCCGTGATCGAGGACCGCCGCCGCCACCTCGCG
GACAAGGAGGCCAACTCGGCCCAGTGCCACGTGCTCAAGGAAACGTTCACTGGCCCAAGCGACGCGCTGCACCGCGCGGGCGGCGTGGACGACCCGGACA
TCGCGCTCATGCACTGGGCCGCGCTCACCGTCGGGTCTGTCGTCAAGCTACACAACCGGGAGACGGCCCCCGCCGACCTGCTCATCCTCGCCGTCTCAGA
GCCCAACCCGAGCGAACCCGCGGGCATTTGCTACGTCGAGACCAAGAGTCTGGACGGAGAGACGAACCTCAAGCTGCGCCACGCGTGCGACCCCACGCTG
CACGTGCAATCGGCGGCGCAAGTCGCGGCGCTCGCCGGCCAGCTGCGCTGTGAGAACCCCAACAAGGCCATTGGCCGCTTCGACGGCACGCTGTCCGTCT
CGGAAGGCACCAAGGTCTCAGAGGCGCACCCGCAGCCCATCGCCATCAAGAACGTGCTGCTACGCGGCTGCCAGCTACGCAACACGGACTGGATCTACGG
CCTCGTGGTGAACACGGGACCCGACACGAAGATCATGCAGAGCGCGGCGGCCACGCGCCCCAAGTGGAGCTCCATCAACGAGACGGTCAACAAGATGATC
ATCTGGCTGTTCCTGCTGCTGTGCTTCTTGTGCATCATCGCCACGACCGTGCAGGTCATCTGGCTCAACAGCAACATCGACGATAGCTGGTACCTCAGCT
GGTCGCCCAGCATCTCGAGCCAGTGGTTTGTCGGCTTCGGCTACTACTTCTTGCTCATGTACCAGATGATCCCCGTGTCGCTGTACGTGACCATCTCGAT
GGTGATGTTTATCCAGGCCATCTTCATGACCTGGGACCTGGACATGTACTACGAGGAGGCGGACGTGCGCATGATTGTGCGCTCCATGGGACTGAACGAG
GAGCTGGGCCAGATCTCTTATGTGTTCAGCGACAAGACGGGCACGCTCACTTGTAACGTGATGGAGTTCCGCAAGTGCTCCATCAACGGCGTGTCGTACG
GCACAGGTATGACGGAAATTGGACGTGCTGCCTTGCGTCGTAAGGGCGTCGCTGTGCCAACGGAAGCGGAGCCGGACCAGGCGTCGCGTCGCACCAAGAT
TCCGTACGTCAATTTCGAGGACGCGCGGCTGTTTAACGCGTTGGAGCGTCCTATCAGCGACGATACGCCGAACCGTGAGGCCGAGTTTTTCCTCCACCTG
AGTTTGTGCCAGACAGTTATCCCGGAGGCCGTGGAAGGCACCTCCGAGGTGCGCTTCTCGGCCTCATCGCCGGATGAACAGGCGCTCGTGTCAGGCGCAA
AGTTCTTCGGCTTCAGCTTCGAATCCCGCGGTCTGGGTGTGGCTCGTGTGCGCGTGAAGAGTCCGGAATTGATCCGACGCTACGCAAATGGCGTCACTGG
CTCAAATGTGCTGCTGGAGTTCCAGATCCTGGACGTTCTGGAGTTCACGAGTGACCGCAAGCGTATGTCGGTCGTTGTGCAGTATCCTAACGGAGAATAC
TGGGTACTGACGAAGGGTGCGGACAATGTGATCTACCCCATGCTGGCCAAGGCTAAGAGTGACCCGGAGATGCTGAAGGAGACAATGCGTCATCTGGAGA
CTTTTGGTGACGACGGTCTGCGTACGCTTACGATCGCGCAGCGTCGCGTGGACGAAAAGGAGTACCTAAACTGGAGCGTGCGCTTCAAGGAGGCAAACTC
GTCTCTGGAAGAGATTGACAAGCGCAAGAACGGCCAGCCGAACGAGATCGACAAGCTGATGACAGAGATCGAGCATGACTTGGAGCTGCTTGGTGCTACG
GCTATCGAAGACAAGCTGCAGAACAATGTGCCCAGCTGCATTGCCAACCTTATGCGCGCTGGAATGCGAGTCTGGATGCTTACGGGTGACAAGCAGGAAA
CTGCGATTAACATTTCTTACGCGTGCCAGCTCATGGATAACGACATGCAGCAGTTTGTCTTCAACTGCGAGTTGTACCCGACCAAGGACGCAATCTTCAC
TCACCTTTCGGAGGCGAACTCACAGGTGCAGCGGGGTGGCGGTCGCCACGCTGTAGTGATTGATGGCGAATGTTTGGAATTGACGCTGGCAGATGAGCGG
TGTCAACACGAGTTTTTATCGCTGGCTATGGCTTGCGAGGCTGTGGTGTGCTGCCGAGTGTCGCCCAGCCAGAAGGCTGAGGTGGTGACGTTAGTACGAA
CTACAAACAAGAAGGTGCGAACGTTGGCGATCGGCGACGGTGCCAACGATGTTGCCATGATTCAGCGCGCGCATGTTGGTGTGGGTATCTCAGGCCAGGA
AGGTATGCAGGCTGTGAACTCTAGTGACTACGCTATCGGTCAGTTTTACTTCCTGGAGAAGCTGCTGCTGCACCACGGCCGTCTGAATTACAAGCGCATG
GCCATTCTGGCCGGATACATGTTCTACAAAAATATTGTGATGGTGCTGGCGCAGTATTTCTACATGTTCTGCACGGGGTCGTCGGGCCAGAAGTTCTACG
GCGAGTTGGGTTTCCAGCTGTACAACATCTGCTACACCTCGCTGCCTATTATCGTGCTGGGCGTGTTCGACTACGACGTGCCCTTTGAAGTGAGCAGACT
TTTCCCGGAGCTGTACCTGGTTGGCCCGCGCATGGAGCTCTTCAACAACTACACGTTCTTCAAGTGGATCTGCAGTGCCGTGTACGAATCCGCTGTCATC
TTTGTGTTCGTCGTGTATGCGTTCAACGAGAACTTCTCCAATGCGGGCAGCGCACCTATGGTGCAGTACGGCTTGCTCGCGTTCACAATGGTGGTGCTGG
TGGCCAACATCAAGCTGTGTATGCTGCAAA