Description :
From Genome Similarity Track
Location :
Scaffold_1203:4260- 7053
Transcript NameFunction/comments
g14162.t1hypothetical protein

Sequence
2793 bases(100 bases per row)
AACATGCCCGGCGCCGATCACAGCTCACACAGGAGGAGCGTGCCGAGGAACGGATAGTAAACCAGGAGCAACATGCCCAGCGCCGATCACAGCTTACGCA
GGAGCAGCGTGCCGAAGATCGCATGATAAACCAAGAGCAACACGCGGAGCGCCGATCACAGCTTACGCAGGAGCAGCGTGCTGAAGAACGGATGGCAAAC
CAAGAGCAACACGTGGAGCGCAGATCACAGCTTACGCAGGAGGAACGCGCCGAAGCGCGAAGGGTAAACCAAGAGCAACATGCGGAACGCCGCAGAGAAC
AGACTGAGGAAGAAGCACTGGAGCAACGCGAGAGAGAGCGATTTCGGCGTAGATCGGCTCGACGTGGAGAGGCGTTGGCAAACCACGACGATTTTGACGT
GGCCTACGTCCAGGGTCCAGACGTTGTGAATGGGCGCCATCGGCTTCCTCCCACCACTGTTTGTGAACATTGTGGCGCTTGGAAGTGGCCTGGCGAATCC
AAAATGAGCTGTTGTCTGGAAGACAAGGTTCGTCTTCCCCCTTTACGGCCTGCACCTCCAAGATTGTTGCAACTGTATCGGGATCCAGCGTTTCGACAGC
ACATACGAGCGTATAACCAAGCTTTTGCGTTCACGTCCATTGGTGCTTCGTGCTCCAACCGATCCTTCCAGGACGTCAACCAGGATGCAAGCGTAGCGGG
ACAGAGGGGCGTGTACACGTACCGCATCCAGGGTGCAATGGGTCACTACTTGGGATCTCTACTCCCCTATATTGATCCCGCCACCGGAGAGCGCACAGAC
CCTAAGTTCGCGCAGATCTATATTGTGGACCCGGACATGCAGCAGCGCGCCCAACGCCGCAGAGGAATTTTTGCTGACTTGGATCCTGTGGCGTTGATGG
ACATTGAGCAAATGATGGAGCAGCACAACCCATTTGCTCAGCAGTTCCTGAGTTTCGGAGAGCAAGTGCGCTCGCGAGACACGAGCGACGTCGTGGATAT
GGTGTTCCGCCTCCACGAAAATATAGCGCATCCTCGGACATACAATTTGCCAACCGTTTCTGAGGTAGGCGCGACGCTCATCGAGGACGGCAACCTGGAT
AGGCCTCGCGATCTACTACTGTATACTCGGGATCACAGGCTTCTGCGACTGTTCGAGACGCGCCCGGAGTATGATCCGCTTCAGTACCTCTTCTGCTTCC
ATATGGGGAGCTGGGTTGGACCTACACGGACACATACGCGAACGGAGTCAGACGTCGCAACAAGAACCAGATGTCCCTTCGCGAACATGTCGCCTTCCGG
TTGCACCAAAAAGTGGGAGATCAGTCTGCTCTTCATCAAGGCGGCCGTCTCTTTCAGCAGTGGTGTGTCGACCAACGCGCTAAATGCGAGCAGGGCAACT
TCGCTGGGTGGCCTCACATCAGAAGCAAATTCGCGCCGATCAGTACCGAGGGCTTCAGGACGCACTGCTGAACGAAGGTACAATTCAGCTGGAAGCAGGC
GAAGGGCTACTCTCCGAGTTTGACAGAGGCGATGGTACGTTGGTCCACCCTGATCGAGGCCGTGGTGGTGATACCCATTTTCTCAACCAAGTGGGACGCC
GCGTTATTCTGCCCTCATCTCATATGGGCAGTCCTCGCGCAATGTACCAGTCCTACCAAGACTCAATGGCCATTGTTAGAGAATTCGGCAAGCCTGATGT
GTTCATGACAACGACCTGCAGCCCTACATGGGAAGAGATAGTCGAGGCCCTTGGGTCCGATCAACAAAACGCTCAGGACCGCCCCGATATTGTAGCCCGT
GTCTGGCAGCAAAAACTGCAAGCTCAGCTTAAAGACCTGAGCGAAGGAGTGCTGGGCCGTATGGAAGCGCGGATTTACGTGGTCGAGTTTCAAAAGAGAG
GGCTCCCTCACGCGCACATCTTGATCATTTTGGCTGAAGAGGACAAGCCGCGTACTCGCCAAATCGTAGATCGTATGGTGTCTGCAGAGCTTCCTGACAG
AGAAAAGTTCCCGCAGCTATTCGAGACGATCATGACATGCATGCTGCATGGACCCTGTGGAGCGGCAAACCCGTCATGCGCTTGCATGAAGGACGGGAAG
TGTACGAAAGGATATCCGAAACCTTTTGCAGAGGCGACAAGGACCAATGTGAACGGCTATCCGGTCTACAGACGGCGTCGACGAGCTGAAGGCGTCTGAT
ATGGAAAGGCAGGGAGTACGACAACGCCACTATTAACCAGTGGGTTGTTCCGTACAACCCGTACTTATCCCAAAAGTACAATTGCCACATCAACGTCGAG
GTGTGCACGGATATTTCAGCTGTGAAATATCTATACAAGTACGTCTACAAAGGGTCCGATAAAGCTGTGTTAACTGTCGAGGCAGTTCGCGCGGGTGGAG
AGCTCCCTCGGCAAGAGCCAAACGAGATTCTGCGCTTCCTCACGGCCAGGTACATATCTCCAGTTGAAGCCTGTATCCGCTTACTCGACTTCTTGATCCA
AGGAAAGACACACGCAGTCACTCAGCTTACCGTTCACGTCGAAGATGCCCAAACCGTGTTCTTCAGAGCGACGGAAGACCCGGAGCGTGTCCTTGGTCGT
GGGAATCACACCATGTTGACCCGCTTCTTCGAATTGTGTGCGAGCGACGAACCCGAGAACCAGATCGCGAAGACAATGCTGTACCAGGATATACCCAAGG
AATTCCGCTGGATGGGAAACACGAAGTGCTGGGTTCGACGTAAAAGGTACCAGGCTGCAATTGGTCGGATGGTGCATGTTTCACCGCGTGATA