Description :
From Genome Similarity Track
Location :
Scaffold_337:426- 7758
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_337-snap-gene-0.13Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_337-snap-gene-0.10Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_337-snap-gene-0.14ATPase

Sequence
7332 bases(100 bases per row)
CGCTTCTTCTCTTCGACTGCCGCTTGGAGAGAAAGTTGCAGCTTTTCCAACGTGTTGAGAAGCTCAAGAGAGCGCTCCAAAACCGTGTTTGACGACTGAA
GAATCGCTTTGGAGGAACCGAGAGTAAGATTCGTCAGTGCAGATGTCTCAGCTGACGAACGCTTCGACACCAACTTCTGGGCTTGACGAACCTGGTATCC
GAAAATCACCGACAGATATGTACGGTGAGCATCACATACGACCTCCCAGTGTAGCAAACATTCCGCGCTCAATACGGGGTGAATCCAATACCTGAGTCAT
GACAGCGCGGATTTTTCCCGAGATCGTGTTGTAGCTGCACTTCATTTGACCGCAGACTTGTGGCAATGTCTCCTGCGCATCAGTGATGTCCAGGACACCA
GGCGTGTGGATACCCTCTTGCGGTTTAATCTCCGAGGTCGGCACGTGGGTGAACAATTTCGCACTGAAGCTGCACTGGTCCACTTGCTTGAAATCGTAAA
AGCGAGGCTTCGTGTCCTTGTTCTTGGTGGGAACGATCTCCAGCATAAAGCTCATTCGGTTGCCAGGCTCACCACATTCATCACCATCGCTAAAGAGCAT
CTGTTTGTATCGCATTGTGACCGGATCAATCTTCCAGCCACGGAAAATGCTACACACACAAACACATCCCGAGCAATTAATACATCTCGACAACCGTGCA
ACAGGCCATCATTACAAGATCTAACCCAAAAAATGCATACCCGAGAATCTTCCTTGTTTCTGGTTCCACTACGTTGTCACTTCCCTCGCTTCCTTCGGCG
GGCTCAGGCTTCTTCACCATGTACGTGACGTTTTTCAAGTGGCAGACGTCAAGCAGCGCCCTACACTCAAGCATCGGATTTTTTTGTCAGCAACGGCATC
ACACATACGTGAGAGATAACATCACAACCACCAGATCATCAAAGCACTCACGTTTCCGTGTTGATCGTCACTGGGTTCTCCTTCAGGCAGTCCAGAGAGT
CGATCGACGATACAAATGGACCTGCATACGCCATCACATCCATTATATCCGCGTCGGTAAGAGCTACAGTCGCTTGTAAGGCTAAGTAAGATTCGCAAAG
CATGCTAACAAATCGAACGCACCTTGGAAATACACCATCGGCTCTCGGAACGGTACGGGATCGAGCGACGGCACATTTTCCTCCGGCGTCGAGCGCGATA
CGATGCGGATGCTCACTTTCGGAGCCGCTGCGCACATGGAACTCCCCGCCACCAGCAATACCGCAACGTAAGCCAGTGCTGTCGCCCGCATCTTCATCGT
CATTCTCGAATTCGTCACTTTCCTGCCTTTGCTTTTGAGCTCTCGCACGGCAAAATGGCAACGTGGCTTGAGCTTCCAGTACAGTATCGTCGACCTTCTG
TTCCGATCAGCATTATGTTATTTGACAGGAACATTTATTTATTTAGAGAGGTTTTACTTCAAACTTGGTTGAAGTGCGAGTGATGGTCACGAGGTTGCAC
TTTGGATTGCCAGCCGCATCGCATTCCGCATTCTGGCCACGAGCTGAGAAGTGAAGCGAAGAGTGAGAGAAGCGAAGGAGGAACGAGAGGATTCATGCGG
GCGACCGAAGTGAGCGACGTAAGCGCAATCGTCAAGCGCGTCGCTGCAGCGAAAGATGCCTTGGAGCGGATCGCTACGCAGAGATCGCAGTTCAGCGGCG
ACGCGATCAACCAGCAAGCGGATGCAGACGCGGACGAGTTGCAGGAGATCGTCGACGGCTTGCAGCAACACGTGATCAAGTTCACTCAGATATCCACAGT
GCTAGGCTTGAGCTCTACACCACTGATGGAAGCTGGTGTTGTGCTGTACAACGCATCTCGAAATGCTTTGAAAGCGATGGCAAAGAGCCACCCGATACGA
CAAGAAGAGAAGGGCCCCGATCAGCAGCACTATTCGAAGCAGAAGCCGACCGAGTCTGTGATTCGATACTGGGTCATCATAGCGAGGTTCTGGGCGTGCA
AGATCATGAACATTTCGTTGTGGCAGTCCAAAAGCTGTGGAGCGCAAGAGCAGGTGGCAGTCAAGAACCAGTCGCGCTACTTCAACGAGTGCATTGACGT
GCTTCGGTCATTTGGACGCGTTGGAGCGCTGCTACTCGAGAACGCCAAAATCGACTTCGAGCGGTGCCAACAATACTTCCACTTCGCTGACGAAGCTTTT
TCCTGCTGTCACCAAATCTGGTCGCAAATTGGACTCTCGTACCTGACAAAACTGAAGCAAGACCTCGAGTTGGAAGAGATTCTTGAAGACTTGTGGGATT
TCAACATGGATCGAATCCGTGTGCTGCAGTTGAACAGCAACGATAAAATCAGCGGCAACAGCGCTAGCAATGTTAGCGGAACAGTTGAAGCACTGGGAGA
ACTGCAGATGCTGGTTCCGTACATGCCGACATACAGAGTGCAGTTGCTGAAGCTTGTGAAAGAAACAAGCGACATCTACAAGAAAGCTGGACGCCATCAA
GAGCAAGTACTGCTCACGGAAGAGGCCCTTCGAGTGTGCGATTCCATGGACACCAGTTTTGAGGATGGTGCGGAGGAGGCGCTGCAGCAATTCAAGCAAG
GTCTTCTTGTAAACGTCTTGGAGACGTTCGGCGCAATGAGAGATTTCCAGCGAGCAGAAACATGCTATTCCCTTCTGCCACAGCATAGAGATTCCGAAGC
TGTGCTCATCATGGTCAAGATCTCAGTTGATGCACAGCTCTTCGACAAAGCTCGCAACTACCTCAAGATTTTGTTCGAGTTGGACAACCTGGAAAGTGCA
ATCCGCGGAGCTCGGATATACGCGCAAGCGCAAGCGTTCAGCGATGAATCCTTGAAGGTGTATCAGGAGCTGGAGCGACATTACGGTGAAGACAATCTCG
AAATTAATCTGGATCTCGCGTGCAATCTCGCATTCTCCACTGTTGCCGAGCGAAGGGAACTCTCGATCGCAGAGCTGAGAAGGATTGCCTCGGAAGTGCA
AAACCTTGCAAGGTAAGACCCAGCGCAGCGACTTGTGATCAGCAAAGAATGATTGACGCGGATGTGTGTGTGTGTTTTTTAGGGAGGAAACTAGCACCAC
CGCCTCCAAACACACAGAGAGGATCCATCGGACCATTTTTGATGCCACTCAGCACCACCTGAACCGTCACGCCTACGAGGTAGGTCTCAAAAACGAATAC
CTAACTTGCTTTCATGTGTGTGGTTAGCTGAGCCATTCAGTGCAAATGCAGGAGTGCATAGAATGGGCTGAGCTGGGCATTGTCCTCGCTTCGAGCGAGC
GTGAATCTGGCGTTTATATGAGGTAACATATTATGCTTCAACTTTTCAACGTGTGGAGTTGGAAGCAGATGAAAACTCATTGCTTTTTTGTCTAGGATAT
TATCGCTGAGCTATCTGCGACTTGGGCAGGAGGGAAATGCACTAAAATGGGCTCGCGAGGCTGTCAACACGGATCCGTCGAAGAAGTCTCTTTTCTCTCT
GTTTAACGCAGAATTGGAAGGACTGGCACCGGGAGAGCAAGCCACGGAGCCGTTCAAAGAGATCATGAAGAGTTTGAAAGCAAGGGACGACTTCGAAATT
GCAGATTTGATCGCTCTTGGAAAATCCGCTTACGACGCTGGGCCGACGAAGCAGATGGCAGTTTTGCAAATCCTGGACGAGCTCTGTTGTCTTGTATCTG
ATAACTCTGAAGATGCTGGTGCAGTACCAATTGGGATCTTACTCCAACATACCGCACATCTGGCGTACAAGTGCTTCTCGGAAGGAGGCTCTACTGCGGA
CAGCTCAAACGGACCTGACAAATTCACCAACAAGTTGAAGAAGTACACACGAATGCTGCTGGACGCTTCGAAAGCAGCCCGAAAGGTTGAACTTGGACCT
CCATCGGTGTTCGAGTGGTTCTATGCGATGAGGTACGGATTTCGCTTACGATAGGAATGGTCCAGTTTTCTTCTTCTAATCCTCCTTCAGCTTCAATTTT
GCGAAAAGCACAGAGAGCTTTGAGTTGTTTATCCTCGCCGCAGAAATCGCAAAGCTTTCCGAAGAGATCTACCAAGACAACAATCCTCTACAGCATCGTC
AGCCTCAATGTCTCTTAGCTGCAATTGCATGCACCATGAAGAGCCTGGAGTCTCTTGAAAAGTCTCGGCTGCAATACCTCCTAGAAATCGTTGAGCAGTG
TGAGGCTTGCCTCATAGATGACGGTCAAGGTATTCAAGACGAGCTCGAATACTTGGTAAGCCACACACACTTTCAGTCGGTATCATATTTCGCAGCTGGA
AGGAGAAAACTCTCATCAAGCATCTTTTGGTAGGCGAAATGTGTGTTTACGATCAAAGTGAGGCTCTTTGATCCAAACACCGACGGGATACTCAAGCTTT
GCAAAGCTAAGATACCAAGACAGGCTGATGAATTCGCGTATCTTGCAGGTGCGGACTCTTCCCTATTCATGTCTTGTGCGCCTCGCTGAGAGGTTTCTAA
CCCAGCGCTTGTGTGTCAATGCAGAGTTTGTTTTGTACGCTGCAAAGTTTGATGAAGCGTCAGAGGTTTGGCAACACTTCCTTTTCCCAACATGGTATCG
CTGTCAACTCAAGTTACCATGCATTTCAGGTCCGAAAAAGCTACAAGCACCTTGCAAGTGATCTTTTCAAATACGGGTAAGTTTGATTGCTCTGCCACTC
AATATGAGTAAGTGTGATCTCACTGTCACTTGCCAGCCTCCAAGTGATGCTACAAAGCGACTCAGTCGCATCTGAGAAGCTCTGCTACCTCTTTCGGCGG
CTGATTTCTCTCGCAGAATCAAAGACGGATGCTCTTGAATGGCTCGAGCAATTTGTCCAGCTTACTGGCAGCTTAGACATCCAGCTCCCTGAAGATGGTA
TCGAGTGGTTGGTTGCGAAGTCATGGAATATTGTGAGTACCGCGCGCTCTACGGTTGCGCACACGCGTACGAGCAAACGGTTTGCTGACATGAACTTTGC
ATGTGTTCATCCAGGGCATTCTTCATCATCGAAACGAGGAGTATGATCAGGCTAGAAAGTTCATGGACACAGCAATGAAGATTCTTGGTACGAAAACCAC
GTGGTCTGCATTTTCGGATGGCATCTATTCTCACCATATCTTTGCCTTAGACAAAAACGACTCTCTTGCAGAGCGCATGAGGTCTGACTTGCGAACCCAG
TACCAGCATTTCCTGTCATCAGTGGCGACAAGTCATCCAGACAAAAAGTGAAACACGTGACCCGAGGATTTTGAGCAGTTCTCTTCTTTTGTTTTTACCA
TTTTTTTGACAGCACTGCATCATTAGATTCTTAGATCCAAATTATGCTCGTGAATTACGCATCGTAAACAGGAGACTGCCCGTTTGGACCGATTCCAAGA
GTATGGATCTTCGTTGCCTCCATGTATGACAAAAGAGTTGGCAATTCTCCAGTCTCTTCTTTCTTCAGCACCTTGGAAGCCCACTTCCGCTCGGCATATT
CGCAGATCTATTGACAAGATACACGAACCAAGTCAAGTCACTGAAGCTTCAGTTTGGAAGCGAGGGTGTCAGACGTACCTCTTTGATATCGCGACATGAA
AGTCCGGTAGAAATCGACGCAAGTTGCGACAGGTCGTCGGAAGAGAGCTGCTTTGCGTATCTACAGTTCGCAACGACACCTGCAGTCAACCACGACGTCA
CCAATTCTCAAAAAGATCAACTCAAGCCACGTACCGTCCAAAGACAGCTTTTCGGGTGTTTTCATCTGGAAGATCATAGCGAATGCAAAGATCAAAGCGA
CTAATCAACGCCGAATCCAAGTCTTGCTTCCTGTTGGTCACCTCAAGAATTAGCGCACCTTTCAACAGAAATCAGGACATTGTCAACAAATCTGCATACC
TATTCGTCGCACAAATCACGGTCGTCTTCTTCGCCGAAGAAAACCCTTCCACCTTCTGAAGCAGTACAGACAAGATTCGTCGTGAGGCTTCGTGCATCGT
GCCGCCAGACCGATCTCCCGCCAACGCATCAATCTGCTCATCAAACACAGTACATACCCTGTGAGCAAACATGGATCTCACATCGGAAACTCCAGAGTCG
CAACGTGAAGATCAAAGCCAACCTCGTCGATGAAAATGATCGCTCCATCTAGCTTCTCGCAGGCGTCGAAAATCGCCGACATCTTCTTCTCGCTGTCCCC
GTACCATTTCGACACGACGCTCTCAATCGGGATATGGATCATCGGGATGCCCGCTTGCTGCGCGATGATTCGAGCACTGAGGGTCTTTCCCGTGCCTGGC
GGGCCTTCAAACAGCACAGCACGCGGGCGATTGCTCTCGTATCGGCAGCGTGTCTTGCGCGCAATCTCCTCGTACAGCTCCGGGTTTTGAAGCGCGAGGA
CAACCGAGTCTTCAATCTCGAGCTTTACCTTGTCGTAGCCAGCCTGAGTATCGACAAAAATCGGGCATCTCAGTCAGTGCTGTCTATCACAGCAAATCAA
GTCCTCAACCAAAAACGAACAGATCCAGTACCAAGCTATCCCAGTTCACACAATTTTCACCCTCTGCGACTTCAAACACGTCGATCCCAAGCGCTTGGAG
CTGCTGGATTGCCTCGTCCTACAAGAGTCCAAGATGCTAGTGTCAGTACTGAATGGGTAACACTATACATTGCATCATAGAGGAGCTATTCTCTTTTTAA
AGCTCACCTTGCTTCCTGCTGGGTTACCAATAGCAGCACTCTTCGCGCCGCCACGGTCTGCGAGCATCTTGCGTCGAGATTGCGACATATCGTGACGAAA
GAACGCGTGCACGTGCGGGTACGAGTAGATCTCCTTGTACGCCCCTACCACCGCGTCCACTTCGCTTTGCGTCAGATATTCGTCCTTGTAGAACACGAAC
GTCGAGCCACGATTCGGCTGCATGGTCTTGTCGCGTAAAAACTGAAAGGAGCCGCGGCCATTTGCGTACAAGTAGGTCACGGACGGCTGCTCGTAGGCTT
CGACAATCGATTTCTGCTCCAGTTTCTCAGGCGGCACGGGAAAGACCTCCACCGACTGCTTCGATTCGCCAGCGCCACCAGCAGAAGGCGAAGAGCTCTT
TTGAAGATTCAGTAAAAAGCGTCCGAGGATCGCTTCTTGGTCGATGAACGGCGGGCACACGAATTCAATGCGGATCGTCGACACGCCGTTGGGGGCGTGG
ATGCGCGAGATGCCGATCTTCTTGATCGGATATGCCTTCGGCACGCGCGTATCCGAGCTCTTCAGCGTCGCGCGGAACTCCGACACTTGCTCGCGGATGA
CGTCCACGACCTGTGCGTACTCGTAGCGCTGC