Description :
From Genome Similarity Track
Location :
Scaffold_941:426- 3432
Transcript NameFunction/comments
Phyag_g8800hypothetical protein PHYSODRAFT_253183

Sequence
3006 bases(100 bases per row)
TCCCAAGCGTTTAACGCAGGAGCAAGGAAGCAAGCTTGCCTCCCGCCCTTTTATCAAAGCAATCCATGCAAAAGTATAGCTCAATCTGCCTACCAACTGC
AATCAGGAGCTCTCGTGtctgtcgttgttgctgttcgtgtcatgaagagctggacgccAGTCAGGGAATTTGGTGCGTTCGGCAATGAGACCCAGCAACA
CTGCGTTTCACACAACACAAAGCAGCCGGGTTAGATGTGCTAGTTTTACTCAACCAAGCTAGCTAGGCATAATATGCTCACCACGGGCCAGGGTCGATCA
AATGTGCATGCATCACGCCGTGCTGCGCTCTTGCTTGATGCGTGGTCGCTCCGTGTCCCGTCGGTTGGAACGAGCGGGCCCATACTTGGTTGTTTTTTTC
GTACGCCCtctggaagacgaagatggagacggaTCTTCAGCTCGATAGTACTGGCTGCGTTCTCGACTCTGGCTGCGGCTAGAGCTGCGGCTTCGACTGT
CCGACCTGCCACGACTGGAACTGTAGTTCcgcttgcgcttcctgctACTTCTCGAGTGCTCGCGCGGGCTTCGAGAGCGGCTCCTGctacgactgctgct
gcgactgtTGTGAGCACGGTGACCACTTCCGTTATCGCGGTTCGACTTCCGATCTCGTCGGTCGAAGTATGACGGGTCACGACGGTAATCGGGGTCTCGA
TCACTGCGTCGATCGTAGCCCCGATCGTCTCTGTCGTAGTGGGAAGACCTTTCACGCGAATCGTACCTGTCATCTCGTCTGCGTTCATAATAGCGGCCTC
TGCTATCGCTGTCCTCATAGTCGTCATAAGCGTAGTCGTATCGGTCTCGGGTGCGACGATCTCCGCTGCGTGCCCGACTGTCGTCTCGCTCATACCCGCT
GCGGCTTCGACTGTGACTACGTTGTCGATAGCGATCTCTTTCGTGGTCGTCACTGCGTCGGTACTCTTCATCTCGACCTCCATATTGTGAACGATTCTCC
ACCTTGATACGGGGCTCATCATCGCCTCGGTATTTTCTTGACacagagctgctgccgtttcGGTTGTCGCGTCTGGAAGAGTTCTGTGCGTTGGATCGGT
TCCCGCCGCCATTTCTCTTGCTAGTTTTAATCCACTCCTTGGAGTCCTCCTCAGTCTTCTTCGTGAACTCCGCCTCATTCAAGATAACCGACGGATCAAG
ACGAAGGCCACCAAGCTGAGACTTGAACACCTCCTTGAGatttgctgcttcgtcaccttctAGTGCACTCGCTGACTTAACTAACGCGTCAAATTCGGTT
TGTTGGCTTTTCTTCCACCTCTGAAGTGATCGATAACTTCGCAGCGCATCCTCTGCAAAAGAGCGCAATGCCAAGAGGTTAATCTGACAAAGTGAGTGAT
AAATGATGTTGCCGTACGTACTAGCTGTTCGCTCGTTGAAAATGTGGCTTTCCTCGCTTGGACTGCACCACTTGAACTTGAAATCTTTCCCTTTGTTCCA
GGTCGCAATGTAAGCCGCTGCCTCCCCAAGTAGCTGCGGTGAAATATCCACGCACACTGGCAGATAGAACCTGAAGGTATTCGACAAACAACGCCGTTAA
GTTAAAATTCAACAGACCGCAAGCGGGCGACGTACAATTCTTCCAGGACTGTTTGCGCGTCGTCATTAATGGCATTGCGGACTGTAGCAAATAACGTTGT
CAGACGGGGTACCTTGTAACAACCATGACGCAGGTTTCAAGCACGTACACTTTTCCGGCATTTTCTCCAACACTCGGCGCAGGTAGTAGAAGGGCATCTC
CGTAGTAAGCTCGAAATTAATACCCTGCAACACCTCCATCTCGTAATACAGTAGCTGCAGGCGCTCGATCTCGAGCAACTCTTCGTCCCCACCGAACAGT
GGGGTCTCCAAAATGTCGTACATGATACGCACCATGCGCAGCAATTTCATACGCTTGCTGGACGCCTTCGCCGAGAGAAAGAGGCAGGCTGCTGCGAATT
TGTACCGCTCCTTCGCGTAAATGCCACGGTCAAACACACGATGGAAAAAGAAGCAGGCAGTGAGCGCGATGTCGCTGCTAAGGCCAAGACACTGCGACAG
GATGTCGATGAAGGCAATAGCCGTGTAGCGCCAGTGCTGTTTCTCCTCGGGCTTGTAGTCGAAGTTGTGGCGCTCGAAAACCAATGGGCAGTTGGACcga
tcaagctgcagctgcggcgtgCTTGGAGGCGGCAGTTCGAACGTCTGAAGCTGATCAGGAGCTTCAGCCTGTCGTTCCGTTTCGCTGCGTGGCAGGGGCA
CTGGGGCCCTCCGAGGCTTACACTCTCCCATCACTAATCCCTTCCAGGCCTTGATTTTCCTCGGATATAGCTTGAGCTCTTCCCACCGAGCGAGGGTCTG
GGATAGTCAACACATATTAGTCTCTTCTCAGGTCAATCACCATAATTCAAGTATCCATCAGCTCACCTTGAACACTCTCTTCCTGTTCTCCTCAGAGTTG
CGTTTGTCTCCATATCGGATCTCCCTGGCACAGGCATTAAGCACTTCATCCACCGTCTGGAACCACTCCCGTTgcacttgttgcagtcgttccCCTTCAA
AAGACTTGAGaaactcgtgcagcacgtAGAAGAGCATCAACTTGGCCTGGAATCCTCGTGCTCCCTCGGCATAAGCTCTCTACAGACAATCACAGACACA
AAACAACCAAAAGCTCGTTAGTTTTCGTGCTTTATgaacaccaacagcaactcaAGTTTCTACAGTACAGAGGTCTATCATATTCTATTAAgcaacgccg
ccaccacaCCACAGCACACGTCAGCCACCGCCAACAAATAAATAACACAACCATGTAGCCATGTAGCAGCTTAGCTTAGTCTGGTGTGAGGGTGTGGTTT
TAGTGGATGGCGGCAGCGGCTTTTTAAGGGTACGTTTTAGCTTCTGTAATGTATCCATAATGGCAAGTacctgcttcatcttgatcTGGAATCGTTGCGC
GTGTTG