Description :
From Genome Similarity Track
Location :
Scaffold_1904:426- 3304
Sequence
2878 bases(100 bases per row)
TAGAGACGACGGATCAGAACTCGGAGGAGGTGGAGCATCATTGGATCCGAGCTCAACACGCATTCGTGGAGTTGAGGAACAGGATCGCGACCACGCCTAT
CCTCCGTCATTTCAATCCAGAACGTCAGCCTACGGTAATAGTTTATACCAGCGACTGGGCAGTCTCAGCAGCTCTGGTACAAGAACATGAGGGGATCTGT
CATCCAGTCACCTTCGTCAGCCAGACACTGAAGCCGAATAAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTATTGGATCTGA
ATTACAACCTGCTGGTGGGAAGATCCATCCGGATCCTGACCCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCCGCGTTATAAAGAGAACTTTGGG
GAAAATGGGCAGCTTTTACTCTCGCTCTGGAAACCTGGAGAATGGTGAAATGTTTCCAAGGGGAAAAACACATTCTGGGGAATTCTGGGCCGCCAGCCTC
ACACCCCCAGCTAGATGAGAGCGCTGACTAGGTCGCTCAAGAAAGAGCCCAAACCCGGATCCAGATCCCGATCCGACGGTACAGGCAGACGAGGATCTGT
ACTCCTGAGTTTGATGGATCCGCTCGCGTACGACGCGGAGGCGGGGCGTACAGTGCAATACTGTGGAGACTACCTGGATGGGAAGTAGTACGGGCCAGAT
CCACTTATGCGGAAGGCCTCACCGTCAACGAAGCGGAGTATAACGGACTACTGCTGGGTTTGGATCTACTAAAGGGACAAGATCCGAAAAGGCTGGTGAT
TTGTGGGGATTCAAATTTGGTGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCTCTAACACTGTTACGGCAGAAAGTGATGATCCACCTG
CGTGGTTGGATGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGCGCCGCTTTACGAAAATCAATGTGGTGTT
GAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTACGCTGAACCGACTAGACGAAGTGGTGGTAGTGAGGTCCGGGAAAAGGACAGTCCAGGTGATGG
CCGTCCACTATGCACCAGAGGAAGGATTGGATCCAACCCCAAAATTCTCGAGGAAACATTTGTGAAGAGAGTCCGCATCGAGCGGATCCTCAAAGCACAG
AACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAAGATGCCAAATCCTACAGCATTATCGCTACGG
ATTACGCGGTGGTCCTGCATGACTTGCTCTTCTATTGCCCCCTACGAAGAGAGTCAACGAGGATTGGGATGGATTGATGAGACTGGTGATGCCGGAAACC
TTACAACAGGATGTCATACACCACTATCACGCTAGCTTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAACGGATCCGGGAATGTTTTCACTGGA
GGGGACTATTCAAGAGCGTACAACGGTATGTCGGGGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATAT
CCAAGCGACTTACCTTTTCCATATCATAGCCATGGGTCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGACCTG
TTTACCGGGTACGTGATAGCCAAAGCTAGTGCGTCTAGAACGGCGCAAACCATTGCTGAATCGTACGAGGAGTGTGTTTTCCGAAGATTTGGAGCTAGCG
AAATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCG
TCCCCAAGCTAACGGGTCGGCCGAGCGCATGGTGCAGACGATCACGAGAGCACTCAAGATGTATGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTAC
GCAGAACGACTCCCCTTCGCGATAAACACCGCCCAAGACAGGATCCGGGGTGATACCCCGTTTTACTTGGTACATGGGTGGGATCTCAAATCCACCATGG
AAGCGGCCATCCCAGTATGCAGCACCAAGAAGAGAAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCTAGATCCCAGGT
GAACGAACGACTGCGGAGTGCGATACAGGATCGAGCGGATCGACACAACGAAGACGCCCGTCCACATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTAT
TTGGATCGAGTGAAAGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCATGGACCGTTCCGGGTGAGCGAGAAGATTGGAGAACACGCGGTAAAGCTGG
AAACGGCAGGTACCGAAAACCGCCTGTTCCCTGTAGTACACGTATCCAAGCTGAAGTTGGTCAAAGAATATCCGGATCGGCCGCAGATCCGTCTTTCGGT
GGATGGATCCGATCGCGTCGACTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGAATGTGGATCTCAAAGCCGACGAGTTCGAAGTCGAGAAGATCACC
GATATGAGGTCGGGGAAGCGAACTAGATACGGACGGATTTACCGTGAATTTCTGGTGTATTGGCGTGGATATGACGAACCCAGTTGGGTAGACGAGGCAG
ATCTGAACTGTGGAGCATTACTCTATGATTTCTTGAGGGATCGTACGAATCGTAACAGATTCGGCGTGATTCAGACTCATGAAGAAGAGTAGGGAGGGGA
TCCATGGATGTGAGTTGGTCATGTCGATGGGAGGATGAAGAAGGACCCACAGGAAGGGTGTGGGCCAGGAGGAGGAGG